Incidental Mutation 'R5694:Efcab5'
ID443835
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene NameEF-hand calcium binding domain 5
Synonyms4930563A03Rik
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77089915-77188968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 77188875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 15 (D15A)
Ref Sequence ENSEMBL: ENSMUSP00000104037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400]
Predicted Effect probably benign
Transcript: ENSMUST00000108400
AA Change: D15A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: D15A

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACCGTACCTGTTGTTGATCG -3'
(R):5'- AAGTACAGCTGCCGTGGAAG -3'

Sequencing Primer
(F):5'- ATCGTATCAGGGACATGAGTCTTCAG -3'
(R):5'- TACAGCTGCCGTGGAAGAAAAATC -3'
Posted On2016-11-09