Incidental Mutation 'H8562:Mtrr'
ID44384
Institutional Source Beutler Lab
Gene Symbol Mtrr
Ensembl Gene ENSMUSG00000034617
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Synonyms
Accession Numbers

Genbank: NM_172480; MGI: 1891037

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8562 (G3) of strain 604
Quality Score225
Status Validated
Chromosome13
Chromosomal Location68560780-68582149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68564377 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 630 (H630R)
Ref Sequence ENSEMBL: ENSMUSP00000152387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045827] [ENSMUST00000223101] [ENSMUST00000223398]
Predicted Effect probably damaging
Transcript: ENSMUST00000045827
AA Change: H630R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039810
Gene: ENSMUSG00000034617
AA Change: H630R

DomainStartEndE-ValueType
Pfam:Flavodoxin_5 5 126 2.7e-9 PFAM
Pfam:Flavodoxin_1 6 142 4.3e-32 PFAM
Pfam:FAD_binding_1 267 490 2.6e-51 PFAM
Pfam:NAD_binding_1 540 660 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220544
AA Change: H162R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000223101
Predicted Effect probably damaging
Transcript: ENSMUST00000223398
AA Change: H630R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.2609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (109/114)
MGI Phenotype FUNCTION: Methionine is an essential amino acid required for protein synthesis and one-carbon metabolism. Its synthesis is catalyzed by the enzyme methionine synthase. Methionine synthase eventually becomes inactive due to the oxidation of its cob(I)alamin cofactor. The protein encoded by this gene regenerates a functional methionine synthase via reductive methylation. It is a member of the ferredoxin-NADP(+) reductase (FNR) family of electron transferases. Mutations in a similar gene in human have been associated with cblE complementation type homocystinuria-megaloblastic anemia and susceptibility to folate-sensitive neural tube defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are viable and display a male-specific reduction in postnatal weight gain as well as hyperhomocysteinemia, hypomethionemia, increased tissue methyltetrahydrofolate, and AdoMet/AdoHcy ratios that range from high to slightly below normal. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Gene trapped(46)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A G 19: 7,422,921 K251E probably benign Het
2810021J22Rik T C 11: 58,880,891 C400R probably damaging Het
4930519F16Rik A T X: 103,255,857 noncoding transcript Het
5430402E10Rik G T X: 77,922,734 H117Q probably damaging Het
Abca15 T C 7: 120,374,854 probably benign Het
Abca8a A G 11: 110,043,009 I1190T probably benign Het
Acmsd T C 1: 127,749,058 Y107H probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Aff2 G A X: 69,848,926 A939T unknown Het
Ampd2 C A 3: 108,081,111 A11S probably benign Het
Aoah T A 13: 20,816,524 C43S probably damaging Het
Apobec4 T C 1: 152,757,174 S318P probably damaging Het
Arid2 C T 15: 96,369,546 P636S possibly damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Bco1 G T 8: 117,105,647 probably benign Het
Brd3 C T 2: 27,450,533 G555S possibly damaging Het
Brd4 A T 17: 32,229,403 probably benign Het
Btbd7 A G 12: 102,788,302 V735A probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Carmil1 A G 13: 24,064,647 V485A probably benign Het
Casz1 T C 4: 148,933,451 L113P probably damaging Het
Ccdc3 T C 2: 5,138,205 L91S probably damaging Het
Cd180 A G 13: 102,705,418 K324R probably benign Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Cops7a A G 6: 124,962,453 probably benign Het
Cyp2c29 A T 19: 39,309,662 N217I probably damaging Het
Dapk1 C A 13: 60,761,312 H1246Q probably damaging Het
Dmbt1 T A 7: 131,112,076 C1450* probably null Het
Dnah10 T A 5: 124,829,529 M4151K probably damaging Het
Dnaic1 C A 4: 41,629,833 F452L possibly damaging Het
Dync1h1 T C 12: 110,616,807 M446T probably benign Het
Dytn A C 1: 63,674,912 S143A possibly damaging Het
E130308A19Rik T A 4: 59,691,033 L289Q possibly damaging Het
Efemp2 G T 19: 5,480,649 V250L probably benign Het
Elmo1 T C 13: 20,280,863 S201P probably damaging Het
Fam208b A T 13: 3,577,000 S983R probably damaging Het
Fam222b T A 11: 78,154,578 C194S probably damaging Het
Fam91a1 G A 15: 58,427,121 probably null Het
Fcf1 T A 12: 84,980,612 probably benign Het
Fnip1 T A 11: 54,480,297 F134L probably damaging Het
Fyn T C 10: 39,511,954 S69P probably benign Het
Gabbr1 T C 17: 37,071,949 Y845H probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm13083 T A 4: 143,615,350 probably benign Het
Gm1966 A G 7: 106,603,149 F296S probably damaging Het
Gm5435 T C 12: 82,495,675 noncoding transcript Het
Gm7251 A G 13: 49,805,672 Y94H probably damaging Het
Heatr1 T A 13: 12,408,713 N530K probably benign Het
Hist1h2bn T C 13: 21,754,478 V119A probably benign Het
Icam5 A T 9: 21,035,146 E355V probably benign Het
Ighv3-6 A G 12: 114,288,538 probably benign Het
Intu T C 3: 40,692,673 S659P probably damaging Het
Ivns1abp T C 1: 151,354,695 V198A probably damaging Het
Katnb1 T A 8: 95,095,510 probably benign Het
Kcna5 T C 6: 126,533,423 S581G probably damaging Het
Kif23 A G 9: 61,924,065 V741A probably benign Het
Lbr A T 1: 181,820,668 probably benign Het
Loxhd1 A C 18: 77,341,931 T508P possibly damaging Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Ly96 A T 1: 16,691,694 K41N probably damaging Het
Lypd1 C T 1: 125,910,537 probably benign Het
Macf1 A G 4: 123,466,040 V1817A probably benign Het
Mknk2 A G 10: 80,668,934 probably benign Het
Mmp19 A T 10: 128,795,601 I117L probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Nfat5 T C 8: 107,339,382 probably benign Het
Ngef C A 1: 87,487,807 K288N possibly damaging Het
Nkain4 T C 2: 180,943,145 E71G probably benign Het
Odc1 T C 12: 17,548,037 Y122H probably benign Het
Olfr384 T C 11: 73,603,447 I289T probably damaging Het
Olfr715 C A 7: 107,129,241 A51S probably benign Het
Olfr919 C A 9: 38,697,910 G156V probably damaging Het
Osbpl3 A T 6: 50,347,466 N190K probably benign Het
Osgepl1 T C 1: 53,315,039 V54A probably damaging Het
Otogl T C 10: 107,910,956 Y19C probably benign Het
Pop1 T C 15: 34,530,212 S919P probably benign Het
Prl8a9 A G 13: 27,562,601 probably benign Het
Prr14l A T 5: 32,793,728 V1907D probably damaging Het
Ptprn T C 1: 75,254,620 T547A possibly damaging Het
Rdh14 G T 12: 10,394,709 V187F probably damaging Het
Rev1 A G 1: 38,056,767 L853P probably damaging Het
Robo4 T C 9: 37,405,810 probably benign Het
Ryr2 A G 13: 11,717,141 probably benign Het
Sec16a G A 2: 26,441,505 P166L probably benign Het
Slc6a19 G A 13: 73,700,124 probably benign Het
Slco4c1 T A 1: 96,842,485 T285S probably benign Het
Speg G T 1: 75,415,597 A1633S probably benign Het
Srpk1 T A 17: 28,602,733 T236S probably benign Het
Stxbp5 T C 10: 9,769,443 N262S probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Syk A G 13: 52,640,621 N441D probably damaging Het
Syt17 T C 7: 118,408,069 K334R probably benign Het
Sytl5 A T X: 9,960,096 H436L probably benign Het
Thada A G 17: 84,446,544 L333P probably damaging Het
Thap12 T C 7: 98,715,107 Y161H probably damaging Het
Thbs2 C T 17: 14,671,453 V941I probably benign Het
Tktl1 A T X: 74,181,864 E72V probably damaging Het
Tm4sf5 T A 11: 70,505,512 probably benign Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vcp T A 4: 42,982,596 I699F probably damaging Het
Vmn1r232 T C 17: 20,913,394 T315A probably benign Het
Vmn2r100 T A 17: 19,521,490 W155R possibly damaging Het
Vmn2r19 T C 6: 123,315,902 I301T possibly damaging Het
Wwc2 A G 8: 47,920,666 V55A possibly damaging Het
Xirp2 A G 2: 67,515,457 T2681A probably benign Het
Zfp39 C A 11: 58,900,686 L58F probably damaging Het
Zfp612 T C 8: 110,090,038 F587L probably damaging Het
Zfp810 T C 9: 22,279,091 R174G probably benign Het
Other mutations in Mtrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Mtrr APN 13 68571147 missense probably damaging 1.00
IGL01806:Mtrr APN 13 68580600 missense possibly damaging 0.92
IGL01808:Mtrr APN 13 68566093 missense probably benign 0.00
IGL01875:Mtrr APN 13 68572609 missense probably damaging 1.00
IGL02137:Mtrr APN 13 68568801 missense possibly damaging 0.75
IGL02186:Mtrr APN 13 68564357 missense probably benign
IGL03114:Mtrr APN 13 68564322 nonsense probably null
3-1:Mtrr UTSW 13 68575016 critical splice donor site probably null
N/A:Mtrr UTSW 13 68575397 splice site probably benign
R0007:Mtrr UTSW 13 68575330 missense probably benign 0.02
R0741:Mtrr UTSW 13 68579539 splice site probably null
R2140:Mtrr UTSW 13 68568940 missense possibly damaging 0.47
R2513:Mtrr UTSW 13 68566973 nonsense probably null
R4604:Mtrr UTSW 13 68564512 splice site probably null
R5501:Mtrr UTSW 13 68579647 missense probably damaging 1.00
R5658:Mtrr UTSW 13 68568915 missense possibly damaging 0.67
R6477:Mtrr UTSW 13 68570073 missense probably damaging 1.00
R6694:Mtrr UTSW 13 68564333 missense probably benign
R6979:Mtrr UTSW 13 68570003 critical splice donor site probably null
R7094:Mtrr UTSW 13 68579684 missense possibly damaging 0.83
R7296:Mtrr UTSW 13 68568860 nonsense probably null
R7354:Mtrr UTSW 13 68566207 missense probably damaging 1.00
R7378:Mtrr UTSW 13 68564402 missense probably damaging 1.00
R7546:Mtrr UTSW 13 68582149 unclassified probably benign
R7562:Mtrr UTSW 13 68566217 missense probably damaging 0.96
R7759:Mtrr UTSW 13 68570027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCCAAAAGCAAAGATTTCTGC -3'
(R):5'- AACCACTGCCTTTCGCTGACTG -3'

Sequencing Primer
(F):5'- GAAACCCTGGCTGTTAACCG -3'
(R):5'- TTCCTCAAGACTGGGGTCTT -3'
Posted On2013-06-11