Incidental Mutation 'R5694:Zfp677'
ID443841
Institutional Source Beutler Lab
Gene Symbol Zfp677
Ensembl Gene ENSMUSG00000062743
Gene Namezinc finger protein 677
SynonymsA830058L05Rik
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21383748-21399265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21397759 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 359 (D359E)
Ref Sequence ENSEMBL: ENSMUSP00000125295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056107] [ENSMUST00000162659]
Predicted Effect probably damaging
Transcript: ENSMUST00000056107
AA Change: D359E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052667
Gene: ENSMUSG00000062743
AA Change: D359E

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162659
AA Change: D359E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125295
Gene: ENSMUSG00000062743
AA Change: D359E

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
Pfam:zf-H2C2_2 118 140 2.9e-5 PFAM
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232365
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Other mutations in Zfp677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfp677 APN 17 21397668 missense probably benign 0.33
IGL01973:Zfp677 APN 17 21396907 missense probably damaging 1.00
IGL02206:Zfp677 APN 17 21393237 missense probably damaging 1.00
IGL03240:Zfp677 APN 17 21396873 missense probably damaging 0.99
IGL03409:Zfp677 APN 17 21396845 missense probably damaging 1.00
R0622:Zfp677 UTSW 17 21397700 missense probably benign 0.04
R0972:Zfp677 UTSW 17 21398310 missense probably damaging 1.00
R1519:Zfp677 UTSW 17 21397237 missense possibly damaging 0.91
R2155:Zfp677 UTSW 17 21397708 missense probably benign 0.01
R2316:Zfp677 UTSW 17 21397320 missense probably benign 0.38
R2866:Zfp677 UTSW 17 21397256 nonsense probably null
R2989:Zfp677 UTSW 17 21396852 missense probably benign 0.11
R3955:Zfp677 UTSW 17 21397817 missense possibly damaging 0.95
R4075:Zfp677 UTSW 17 21398159 missense probably damaging 1.00
R4134:Zfp677 UTSW 17 21397781 missense probably benign 0.01
R4229:Zfp677 UTSW 17 21398282 missense probably damaging 1.00
R4729:Zfp677 UTSW 17 21397418 missense possibly damaging 0.51
R4843:Zfp677 UTSW 17 21392526 missense probably benign 0.23
R5023:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
R5316:Zfp677 UTSW 17 21397148 missense probably damaging 0.99
R5420:Zfp677 UTSW 17 21397913 missense probably damaging 1.00
R5837:Zfp677 UTSW 17 21397386 missense probably damaging 1.00
R5888:Zfp677 UTSW 17 21398258 missense probably damaging 1.00
R6007:Zfp677 UTSW 17 21397656 missense probably damaging 1.00
R6119:Zfp677 UTSW 17 21397808 missense possibly damaging 0.55
R6190:Zfp677 UTSW 17 21397268 missense possibly damaging 0.91
R6518:Zfp677 UTSW 17 21398130 missense probably damaging 1.00
R7198:Zfp677 UTSW 17 21398417 missense probably damaging 1.00
R7391:Zfp677 UTSW 17 21398391 missense possibly damaging 0.56
R7801:Zfp677 UTSW 17 21398015 missense probably damaging 1.00
R7808:Zfp677 UTSW 17 21397385 missense probably damaging 1.00
RF003:Zfp677 UTSW 17 21397442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGGGGAGAAGCCTTACAA -3'
(R):5'- TCTCTCCAGGATGCAAATTCTGAT -3'

Sequencing Primer
(F):5'- CAGAATTTGCATCCTGGAGC -3'
(R):5'- TCTGATGTATTTTAAGGGATGACATG -3'
Posted On2016-11-09