Incidental Mutation 'R5694:Rab44'
ID443842
Institutional Source Beutler Lab
Gene Symbol Rab44
Ensembl Gene ENSMUSG00000064147
Gene NameRAB44, member RAS oncogene family
Synonyms9830134C10Rik
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5694 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location29135056-29148980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29140500 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 554 (L554P)
Ref Sequence ENSEMBL: ENSMUSP00000085253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087942]
Predicted Effect probably damaging
Transcript: ENSMUST00000087942
AA Change: L554P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085253
Gene: ENSMUSG00000064147
AA Change: L554P

DomainStartEndE-ValueType
coiled coil region 1 68 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
RAB 538 701 1.11e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147311
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Htr7 T C 19: 36,057,121 M45V probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Rab44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Rab44 APN 17 29139737 missense probably benign
IGL01545:Rab44 APN 17 29147377 missense unknown
IGL02314:Rab44 APN 17 29139353 missense probably benign 0.04
IGL02402:Rab44 APN 17 29140516 missense probably benign 0.01
IGL02492:Rab44 APN 17 29146049 splice site probably benign
R0018:Rab44 UTSW 17 29139380 missense probably benign 0.03
R0135:Rab44 UTSW 17 29138132 missense probably benign 0.01
R0193:Rab44 UTSW 17 29140307 missense probably benign
R0398:Rab44 UTSW 17 29145370 splice site probably benign
R0403:Rab44 UTSW 17 29145261 missense probably damaging 1.00
R0608:Rab44 UTSW 17 29147343 splice site probably null
R0631:Rab44 UTSW 17 29139144 missense possibly damaging 0.91
R0762:Rab44 UTSW 17 29145270 missense unknown
R1128:Rab44 UTSW 17 29140461 missense possibly damaging 0.90
R1681:Rab44 UTSW 17 29140124 missense possibly damaging 0.47
R1706:Rab44 UTSW 17 29138106 missense probably damaging 1.00
R2679:Rab44 UTSW 17 29144477 splice site probably null
R3500:Rab44 UTSW 17 29138067 missense probably benign 0.09
R3709:Rab44 UTSW 17 29139869 missense probably benign 0.08
R4497:Rab44 UTSW 17 29139897 missense probably benign 0.04
R4655:Rab44 UTSW 17 29139194 missense probably benign
R4833:Rab44 UTSW 17 29136337 missense probably damaging 1.00
R4850:Rab44 UTSW 17 29140089 missense possibly damaging 0.95
R4926:Rab44 UTSW 17 29139555 missense probably benign 0.01
R5694:Rab44 UTSW 17 29145966 missense unknown
R5835:Rab44 UTSW 17 29148238 missense probably benign 0.13
R6146:Rab44 UTSW 17 29135417 start gained probably benign
R6629:Rab44 UTSW 17 29135780 start gained probably benign
R6814:Rab44 UTSW 17 29139810 missense probably benign 0.18
R6865:Rab44 UTSW 17 29139227 missense probably benign
R6872:Rab44 UTSW 17 29139810 missense probably benign 0.18
R7032:Rab44 UTSW 17 29140464 missense unknown
R7058:Rab44 UTSW 17 29138176 splice site probably null
R7207:Rab44 UTSW 17 29138039 nonsense probably null
R7218:Rab44 UTSW 17 29139444 missense
R7418:Rab44 UTSW 17 29140496 missense unknown
R7651:Rab44 UTSW 17 29148205 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTCAGGTGGAGAGCAAGTC -3'
(R):5'- GGACCTAAATTGCACGGTGC -3'

Sequencing Primer
(F):5'- AGAGCAAGTCAGGTGCCC -3'
(R):5'- CCTGTGGTGCATTATAAGCTAACCAG -3'
Posted On2016-11-09