Incidental Mutation 'R5694:Htr7'
ID443848
Institutional Source Beutler Lab
Gene Symbol Htr7
Ensembl Gene ENSMUSG00000024798
Gene Name5-hydroxytryptamine (serotonin) receptor 7
Synonyms5-HT7
MMRRC Submission 043325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5694 (G1)
Quality Score88
Status Not validated
Chromosome19
Chromosomal Location35958734-36057507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36057121 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 45 (M45V)
Ref Sequence ENSEMBL: ENSMUSP00000131517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099505] [ENSMUST00000164639] [ENSMUST00000164781] [ENSMUST00000165215] [ENSMUST00000166074] [ENSMUST00000170360]
Predicted Effect probably benign
Transcript: ENSMUST00000099505
AA Change: M45V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798
AA Change: M45V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164639
AA Change: M45V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126847
Gene: ENSMUSG00000024798
AA Change: M45V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 1.3e-9 PFAM
Pfam:7tm_1 101 387 1.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164781
AA Change: M45V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131912
Gene: ENSMUSG00000024798
AA Change: M45V

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 185 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165215
AA Change: M45V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128386
Gene: ENSMUSG00000024798
AA Change: M45V

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 183 7.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166074
AA Change: M45V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126150
Gene: ENSMUSG00000024798
AA Change: M45V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.7e-9 PFAM
Pfam:7tm_1 101 387 5.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170360
AA Change: M45V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131517
Gene: ENSMUSG00000024798
AA Change: M45V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 247 9.6e-9 PFAM
Pfam:7tm_1 101 252 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower electrically- and chemically-induced seizure thresholds. Mice homozygous for a different knock-out allele show enhanced coordination and higher thermal nociceptive thresholds. Other nullizygous mutantsfail to exhibit agonist-induced hypothermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,600,947 I1353N probably damaging Het
Actr1a C A 19: 46,395,718 probably benign Het
Adamts14 A T 10: 61,229,652 M356K probably benign Het
Adamtsl2 A G 2: 27,081,724 H7R probably benign Het
Angptl2 T C 2: 33,228,616 V134A probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Astn2 T C 4: 65,950,138 D488G probably damaging Het
Cat A T 2: 103,472,994 V146E probably damaging Het
Dmxl1 T C 18: 49,894,257 V2144A probably damaging Het
Efcab5 T G 11: 77,188,875 D15A probably benign Het
Epha10 C T 4: 124,902,653 A385V unknown Het
Erg C A 16: 95,361,031 E388D probably benign Het
Fam126a C A 5: 23,991,796 L31F probably damaging Het
Fbxo10 T A 4: 45,035,970 I931F probably damaging Het
Frem1 A G 4: 82,994,116 L673P probably damaging Het
Gm4922 A C 10: 18,784,287 I229S possibly damaging Het
Gnptab T A 10: 88,414,486 D153E probably benign Het
Igkv4-51 C T 6: 69,681,927 V5M probably damaging Het
Ints7 G A 1: 191,586,618 E156K probably damaging Het
Map3k21 A G 8: 125,944,768 T932A probably benign Het
Mapk1 T G 16: 17,018,469 D160E probably benign Het
Mast4 A T 13: 102,774,193 Y479* probably null Het
Meig1 T A 2: 3,411,962 K7N probably damaging Het
Mthfd1l T A 10: 4,035,239 D548E possibly damaging Het
Myo16 A G 8: 10,569,606 R1386G probably benign Het
Nphs2 T C 1: 156,326,037 S353P probably benign Het
Olfr533 T C 7: 140,466,731 F177L probably benign Het
Olfr906 T A 9: 38,488,236 I69K probably damaging Het
Pcdha9 G T 18: 36,998,372 V165L probably benign Het
Pde3a T A 6: 141,250,502 S305T possibly damaging Het
Phf14 C A 6: 11,990,125 L718I possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Rab44 T C 17: 29,140,500 L554P probably damaging Het
Rab44 T A 17: 29,145,966 M645K unknown Het
Rnf222 A G 11: 68,892,897 T97A probably benign Het
Rnpepl1 T C 1: 92,918,941 S522P probably benign Het
Serinc5 A G 13: 92,688,794 I244V probably benign Het
Serpinb10 A T 1: 107,535,457 probably null Het
Siglech T A 7: 55,768,656 F124Y probably damaging Het
Smarcc2 A T 10: 128,484,127 I790L probably benign Het
Sos2 C A 12: 69,590,915 R1007S probably damaging Het
Stk4 C T 2: 164,100,564 T372M possibly damaging Het
Tbc1d10c A T 19: 4,184,964 L366H probably damaging Het
Tor4a T C 2: 25,194,920 T324A probably benign Het
Trim12a C A 7: 104,307,243 C30F probably damaging Het
Ttll3 G A 6: 113,399,708 V350M probably damaging Het
Uggt1 A T 1: 36,179,656 D63E probably damaging Het
Unc5b G A 10: 60,773,747 T590I probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls A C 3: 159,839,987 I16L probably benign Het
Zfp101 T C 17: 33,380,945 I612M probably benign Het
Zfp677 C A 17: 21,397,759 D359E probably damaging Het
Other mutations in Htr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Htr7 APN 19 35960362 missense probably benign 0.00
R0009:Htr7 UTSW 19 36041540 intron probably benign
R0318:Htr7 UTSW 19 35969486 missense probably damaging 1.00
R1695:Htr7 UTSW 19 35969736 missense probably benign 0.01
R2316:Htr7 UTSW 19 35969303 critical splice donor site probably null
R3973:Htr7 UTSW 19 36056760 missense probably damaging 1.00
R5041:Htr7 UTSW 19 36057067 missense probably benign 0.10
R5203:Htr7 UTSW 19 35964392 missense probably benign 0.00
R5236:Htr7 UTSW 19 36056769 missense probably damaging 1.00
R5538:Htr7 UTSW 19 35969835 missense probably benign 0.34
R5682:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5683:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5684:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5686:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R6273:Htr7 UTSW 19 36041569 intron probably benign
R6502:Htr7 UTSW 19 35969610 missense probably damaging 1.00
R6558:Htr7 UTSW 19 36057240 missense probably damaging 1.00
R6884:Htr7 UTSW 19 35964379 critical splice donor site probably null
R7074:Htr7 UTSW 19 36056883 missense probably damaging 0.99
R7592:Htr7 UTSW 19 36056892 missense probably damaging 1.00
X0064:Htr7 UTSW 19 36056755 missense possibly damaging 0.70
Z1176:Htr7 UTSW 19 35969423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCACCACCAGGCAGTTGC -3'
(R):5'- CAAGGTGAATCCAGCCCTG -3'

Sequencing Primer
(F):5'- AGTTGCCCGCGATCGTCAG -3'
(R):5'- ATGGACGTTAACAGCAGC -3'
Posted On2016-11-09