Mutagenetix > Incidental Mutation

Incidental Mutation 'R5695:Cntnap3'

443897

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

043326-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R5695 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64787955 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 365 (S365P)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: S365P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: S365P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.1353

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd4	T	A	12: 84,613,971	H116L	probably damaging	Het
Anapc4	C	T	5: 52,862,239	S581L	probably benign	Het
Ano8	A	C	8: 71,483,243	D276E	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Bend7	G	A	2: 4,763,241	R336Q	probably damaging	Het
Bpifb4	G	A	2: 153,942,923	G184S	probably damaging	Het
Cbx8	T	C	11: 119,039,311	D152G	probably benign	Het
Cdca2	A	G	14: 67,705,629		probably null	Het
Cgn	G	A	3: 94,773,635	A531V	probably benign	Het
Cmya5	C	A	13: 93,045,866		probably null	Het
Crnn	A	G	3: 93,149,023	Q372R	probably damaging	Het
Ehf	T	A	2: 103,266,779	E276V	probably damaging	Het
Eif4g3	T	A	4: 138,163,433		probably null	Het
Enpep	C	T	3: 129,309,099	D403N	probably damaging	Het
Enpp1	T	C	10: 24,654,908	E550G	probably damaging	Het
Entpd8	A	G	2: 25,084,334	D377G	probably benign	Het
Epc2	T	A	2: 49,547,607		probably null	Het
Erich3	G	T	3: 154,733,573	G481V	probably damaging	Het
Fank1	A	G	7: 133,869,346	Y156C	probably damaging	Het
Fras1	A	G	5: 96,781,344	D3869G	probably damaging	Het
Gcnt2	A	G	13: 40,918,199	D106G	probably benign	Het
Gm20830	A	T	Y: 6,916,501	V206E	probably benign	Het
Gmpr2	T	C	14: 55,677,234	V228A	possibly damaging	Het
Gon4l	TGAGCA	TGAGCAGAGCA	3: 88,896,216		probably null	Het
Gtpbp1	G	A	15: 79,712,174		probably null	Het
Hhat	A	T	1: 192,717,019	M271K	probably damaging	Het
Hipk2	A	T	6: 38,818,875	M153K	possibly damaging	Het
Hydin	A	T	8: 110,535,283	H2672L	probably benign	Het
Igfbpl1	A	T	4: 45,826,374	D140E	probably damaging	Het
Kctd1	T	G	18: 15,063,516		probably benign	Het
Lax1	A	T	1: 133,680,578	Y142N	probably damaging	Het
Lpin2	C	T	17: 71,244,803	R733C	probably damaging	Het
Morn4	A	G	19: 42,076,117	L144P	possibly damaging	Het
Nup214	C	A	2: 32,034,373	T1638K	probably damaging	Het
Nyap1	C	T	5: 137,734,984	A596T	probably damaging	Het
Oas1d	T	C	5: 120,915,011	M43T	probably benign	Het
Olfr724	T	C	14: 49,960,623	T150A	probably benign	Het
Olfr901	A	G	9: 38,431,176	H298R	probably benign	Het
Olfr986	T	C	9: 40,187,601	V162A	probably benign	Het
Pacs1	A	G	19: 5,136,791	F851S	probably damaging	Het
Pcdh17	A	G	14: 84,446,360	Q89R	probably damaging	Het
Phrf1	A	G	7: 141,258,465		probably benign	Het
Plekhb1	A	T	7: 100,655,395	I34N	probably damaging	Het
Ralgapa2	T	C	2: 146,333,477	E1800G	probably damaging	Het
Rbm33	A	T	5: 28,339,012	I89F	probably damaging	Het
Rtl1	T	A	12: 109,594,097	E436V	probably damaging	Het
Slc2a4	G	T	11: 69,946,391	P73Q	probably damaging	Het
Sorbs2	A	T	8: 45,792,875	T311S	probably benign	Het
Sulf2	G	A	2: 166,132,758	A2V	probably benign	Het
Supt16	A	T	14: 52,174,144		probably null	Het
Vmn1r26	A	T	6: 58,008,753	N150K	probably damaging	Het
Vmn2r39	T	A	7: 9,025,151	H407L	possibly damaging	Het
Vmn2r84	T	A	10: 130,389,195	Y482F	probably benign	Het
Vps9d1	T	C	8: 123,246,916	E376G	probably benign	Het
Wrn	C	A	8: 33,324,318	G366V	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCAAACTTCCTGAACCGTG -3'
(R):5'- TTAATCACTGAGCCATCTCACCATC -3'

Sequencing Primer
(F):5'- TGAACCGTGCCCCACTTG -3'
(R):5'- ACCAAAAAGCGAAGAATGAATTTTC -3'

Posted On

2016-11-09