Incidental Mutation 'R5695:Gtpbp1'
ID443904
Institutional Source Beutler Lab
Gene Symbol Gtpbp1
Ensembl Gene ENSMUSG00000042535
Gene NameGTP binding protein 1
SynonymsGP-1, GTPBP1
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79690845-79721479 bp(+) (GRCm38)
Type of Mutationunclassified (1 bp from exon)
DNA Base Change (assembly) G to A at 79712174 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046463] [ENSMUST00000229046] [ENSMUST00000230262] [ENSMUST00000231095]
Predicted Effect probably damaging
Transcript: ENSMUST00000046463
AA Change: V305M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043575
Gene: ENSMUSG00000042535
AA Change: V305M

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
Pfam:GTP_EFTU 160 385 2.7e-24 PFAM
low complexity region 402 420 N/A INTRINSIC
SCOP:d1exma2 491 575 4e-19 SMART
low complexity region 605 619 N/A INTRINSIC
low complexity region 645 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228991
Predicted Effect probably benign
Transcript: ENSMUST00000229046
Predicted Effect probably benign
Transcript: ENSMUST00000229583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230023
Predicted Effect probably null
Transcript: ENSMUST00000230262
Predicted Effect possibly damaging
Transcript: ENSMUST00000231095
AA Change: V78M

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.3092 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted null mutation were viable and fertile with no obvious morphological or behavioral defects. In addition, no defects in macrophage function were observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Lpin2 C T 17: 71,244,803 R733C probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Gtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Gtpbp1 APN 15 79719136 missense possibly damaging 0.90
IGL01783:Gtpbp1 APN 15 79716197 missense probably damaging 1.00
IGL01794:Gtpbp1 APN 15 79716246 missense probably damaging 1.00
IGL01859:Gtpbp1 APN 15 79719140 missense probably benign
IGL02245:Gtpbp1 APN 15 79690926 missense probably benign 0.02
IGL02532:Gtpbp1 APN 15 79720077 missense probably benign 0.05
IGL02730:Gtpbp1 APN 15 79719171 missense probably benign
IGL02796:Gtpbp1 UTSW 15 79716985 missense possibly damaging 0.83
R0525:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0531:Gtpbp1 UTSW 15 79720091 missense probably damaging 1.00
R0535:Gtpbp1 UTSW 15 79707732 missense probably damaging 1.00
R0665:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0760:Gtpbp1 UTSW 15 79719155 missense probably damaging 0.99
R0799:Gtpbp1 UTSW 15 79716200 missense probably damaging 1.00
R1445:Gtpbp1 UTSW 15 79713448 missense possibly damaging 0.82
R1458:Gtpbp1 UTSW 15 79707729 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1498:Gtpbp1 UTSW 15 79719021 splice site probably null
R1567:Gtpbp1 UTSW 15 79712190 missense probably damaging 0.98
R3028:Gtpbp1 UTSW 15 79715879 missense possibly damaging 0.64
R4431:Gtpbp1 UTSW 15 79716197 missense probably damaging 1.00
R4583:Gtpbp1 UTSW 15 79715951 missense possibly damaging 0.64
R4854:Gtpbp1 UTSW 15 79719205 missense probably benign
R4925:Gtpbp1 UTSW 15 79715968 missense probably benign 0.23
R5023:Gtpbp1 UTSW 15 79719221 missense possibly damaging 0.49
R5052:Gtpbp1 UTSW 15 79715969 missense probably damaging 1.00
R6009:Gtpbp1 UTSW 15 79712096 missense probably damaging 1.00
R6089:Gtpbp1 UTSW 15 79706997 missense probably benign 0.15
R7088:Gtpbp1 UTSW 15 79719282 missense
R7343:Gtpbp1 UTSW 15 79691042 missense probably benign 0.03
R7383:Gtpbp1 UTSW 15 79716153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGACAAGCTTTCCCC -3'
(R):5'- GATCCTACACTTGGAAGCAGG -3'

Sequencing Primer
(F):5'- AGACAAGCTTTCCCCGGCAG -3'
(R):5'- AGACTCTGTCTGATGGACCC -3'
Posted On2016-11-09