Incidental Mutation 'R5695:Kctd1'
ID 443906
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Name potassium channel tetramerisation domain containing 1
Synonyms 4933402K10Rik
MMRRC Submission 043326-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5695 (G1)
Quality Score 148
Status Validated
Chromosome 18
Chromosomal Location 15101742-15284503 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to G at 15196573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025992
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168989
AA Change: S17R
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: S17R

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,660,745 (GRCm39) H116L probably damaging Het
Anapc4 C T 5: 53,019,581 (GRCm39) S581L probably benign Het
Ano8 A C 8: 71,935,887 (GRCm39) D276E probably damaging Het
Aspm G A 1: 139,407,407 (GRCm39) R2098H probably benign Het
Bend7 G A 2: 4,768,052 (GRCm39) R336Q probably damaging Het
Bpifb4 G A 2: 153,784,843 (GRCm39) G184S probably damaging Het
Cbx8 T C 11: 118,930,137 (GRCm39) D152G probably benign Het
Cdca2 A G 14: 67,943,078 (GRCm39) probably null Het
Cgn G A 3: 94,680,945 (GRCm39) A531V probably benign Het
Cmya5 C A 13: 93,182,374 (GRCm39) probably null Het
Cntnap3 A G 13: 64,935,769 (GRCm39) S365P probably damaging Het
Crnn A G 3: 93,056,330 (GRCm39) Q372R probably damaging Het
Ehf T A 2: 103,097,124 (GRCm39) E276V probably damaging Het
Eif4g3 T A 4: 137,890,744 (GRCm39) probably null Het
Enpep C T 3: 129,102,748 (GRCm39) D403N probably damaging Het
Enpp1 T C 10: 24,530,806 (GRCm39) E550G probably damaging Het
Entpd8 A G 2: 24,974,346 (GRCm39) D377G probably benign Het
Epc2 T A 2: 49,437,619 (GRCm39) probably null Het
Erich3 G T 3: 154,439,210 (GRCm39) G481V probably damaging Het
Fank1 A G 7: 133,471,075 (GRCm39) Y156C probably damaging Het
Fras1 A G 5: 96,929,203 (GRCm39) D3869G probably damaging Het
Gcnt2 A G 13: 41,071,675 (GRCm39) D106G probably benign Het
Gm20830 A T Y: 6,916,501 (GRCm39) V206E probably benign Het
Gmpr2 T C 14: 55,914,691 (GRCm39) V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,803,523 (GRCm39) probably null Het
Gtpbp1 G A 15: 79,596,375 (GRCm39) probably null Het
Hhat A T 1: 192,399,327 (GRCm39) M271K probably damaging Het
Hipk2 A T 6: 38,795,810 (GRCm39) M153K possibly damaging Het
Hydin A T 8: 111,261,915 (GRCm39) H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 (GRCm39) D140E probably damaging Het
Lax1 A T 1: 133,608,316 (GRCm39) Y142N probably damaging Het
Lpin2 C T 17: 71,551,798 (GRCm39) R733C probably damaging Het
Morn4 A G 19: 42,064,556 (GRCm39) L144P possibly damaging Het
Nup214 C A 2: 31,924,385 (GRCm39) T1638K probably damaging Het
Nyap1 C T 5: 137,733,246 (GRCm39) A596T probably damaging Het
Oas1d T C 5: 121,053,074 (GRCm39) M43T probably benign Het
Or4l15 T C 14: 50,198,080 (GRCm39) T150A probably benign Het
Or6x1 T C 9: 40,098,897 (GRCm39) V162A probably benign Het
Or8b42 A G 9: 38,342,472 (GRCm39) H298R probably benign Het
Pacs1 A G 19: 5,186,819 (GRCm39) F851S probably damaging Het
Pcdh17 A G 14: 84,683,800 (GRCm39) Q89R probably damaging Het
Phrf1 A G 7: 140,838,378 (GRCm39) probably benign Het
Plekhb1 A T 7: 100,304,602 (GRCm39) I34N probably damaging Het
Ralgapa2 T C 2: 146,175,397 (GRCm39) E1800G probably damaging Het
Rbm33 A T 5: 28,544,010 (GRCm39) I89F probably damaging Het
Rtl1 T A 12: 109,560,531 (GRCm39) E436V probably damaging Het
Slc2a4 G T 11: 69,837,217 (GRCm39) P73Q probably damaging Het
Sorbs2 A T 8: 46,245,912 (GRCm39) T311S probably benign Het
Sulf2 G A 2: 165,974,678 (GRCm39) A2V probably benign Het
Supt16 A T 14: 52,411,601 (GRCm39) probably null Het
Vmn1r26 A T 6: 57,985,738 (GRCm39) N150K probably damaging Het
Vmn2r39 T A 7: 9,028,150 (GRCm39) H407L possibly damaging Het
Vmn2r84 T A 10: 130,225,064 (GRCm39) Y482F probably benign Het
Vps9d1 T C 8: 123,973,655 (GRCm39) E376G probably benign Het
Wrn C A 8: 33,814,346 (GRCm39) G366V probably benign Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15,195,747 (GRCm39) missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01404:Kctd1 APN 18 15,102,610 (GRCm39) missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15,195,694 (GRCm39) missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15,195,937 (GRCm39) missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 15,102,667 (GRCm39) missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 15,107,036 (GRCm39) critical splice donor site probably null
R0128:Kctd1 UTSW 18 15,107,237 (GRCm39) missense probably benign 0.00
R0598:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15,195,654 (GRCm39) missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15,195,517 (GRCm39) missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 15,102,617 (GRCm39) missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15,196,263 (GRCm39) intron probably benign
R1779:Kctd1 UTSW 18 15,194,839 (GRCm39) missense probably benign 0.01
R2083:Kctd1 UTSW 18 15,107,112 (GRCm39) missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15,195,268 (GRCm39) missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 15,107,143 (GRCm39) missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15,140,757 (GRCm39) missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15,196,284 (GRCm39) intron probably benign
R4884:Kctd1 UTSW 18 15,107,311 (GRCm39) missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15,195,580 (GRCm39) missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15,195,822 (GRCm39) missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15,195,322 (GRCm39) missense possibly damaging 0.86
R5893:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R6175:Kctd1 UTSW 18 15,102,688 (GRCm39) nonsense probably null
R6767:Kctd1 UTSW 18 15,195,232 (GRCm39) missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 15,119,401 (GRCm39) missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 15,107,045 (GRCm39) missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15,195,700 (GRCm39) missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15,195,469 (GRCm39) missense possibly damaging 0.95
R7688:Kctd1 UTSW 18 15,107,255 (GRCm39) missense probably benign 0.03
R8085:Kctd1 UTSW 18 15,140,901 (GRCm39) missense possibly damaging 0.95
R8195:Kctd1 UTSW 18 15,196,300 (GRCm39) missense unknown
R8496:Kctd1 UTSW 18 15,107,228 (GRCm39) missense probably damaging 1.00
R8924:Kctd1 UTSW 18 15,102,745 (GRCm39) missense possibly damaging 0.93
R8978:Kctd1 UTSW 18 15,119,491 (GRCm39) missense
R9094:Kctd1 UTSW 18 15,195,369 (GRCm39) missense possibly damaging 0.71
R9255:Kctd1 UTSW 18 15,194,853 (GRCm39) missense probably benign 0.00
R9629:Kctd1 UTSW 18 15,196,611 (GRCm39) missense unknown
R9680:Kctd1 UTSW 18 15,140,822 (GRCm39) missense probably damaging 1.00
Z1176:Kctd1 UTSW 18 15,196,182 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGTACTCCCGGAAGATG -3'
(R):5'- CGGAATGACAATTGGAGCGC -3'

Sequencing Primer
(F):5'- CATATGGATCATATGGACCGGCTC -3'
(R):5'- AGCGCGGCTCCTTTAAGAG -3'
Posted On 2016-11-09