Incidental Mutation 'R5658:Tnfaip6'
ID443916
Institutional Source Beutler Lab
Gene Symbol Tnfaip6
Ensembl Gene ENSMUSG00000053475
Gene Nametumor necrosis factor alpha induced protein 6
SynonymsTnfip6, TSG-6, Tsg6
MMRRC Submission 043172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5658 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location52038009-52056686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52051035 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 196 (Y196F)
Ref Sequence ENSEMBL: ENSMUSP00000069231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065927]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065927
AA Change: Y196F

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069231
Gene: ENSMUSG00000053475
AA Change: Y196F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LINK 34 129 1.06e-53 SMART
CUB 135 247 2.66e-47 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
PHENOTYPE: Females lacking functional copies of this gene are infertile due to failed cumulus-oocyte complex expansion. Mice show attenuated acute allergic pulmonary inflammation and are resistant to induction of airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,447 L221P probably damaging Het
Art2b A G 7: 101,580,362 V110A probably damaging Het
Bccip A G 7: 133,717,620 I147V possibly damaging Het
Bcl9l G T 9: 44,509,169 G1254W probably damaging Het
Cep68 C T 11: 20,241,885 probably null Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
F5 C A 1: 164,192,338 T794K probably damaging Het
Faf2 T C 13: 54,641,534 V55A probably benign Het
Gm7535 T A 17: 17,911,320 probably benign Het
Gm853 A G 4: 130,220,441 V61A probably benign Het
Gm9833 C T 3: 10,088,777 S202F probably damaging Het
Itpr3 T C 17: 27,107,878 V1471A possibly damaging Het
Kbtbd4 T A 2: 90,906,079 S145T probably benign Het
Kcnh3 C T 15: 99,242,076 P948S possibly damaging Het
Kcnq1 G A 7: 143,363,695 probably null Het
Kng2 T C 16: 22,997,020 probably null Het
Krt9 A G 11: 100,190,767 I312T probably damaging Het
Lactb2 T A 1: 13,627,418 H254L probably benign Het
Lama5 A T 2: 180,208,276 Y187* probably null Het
Maf1 T C 15: 76,353,220 V154A possibly damaging Het
Mlh1 A G 9: 111,247,380 V303A probably damaging Het
Mrgprh A T 17: 12,877,759 K295N possibly damaging Het
Mtrr G T 13: 68,568,915 A393D possibly damaging Het
Nebl A G 2: 17,348,852 Y963H probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Pmpcb A G 5: 21,739,001 T78A probably damaging Het
Ptprz1 G A 6: 23,016,189 R1677Q probably damaging Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Ryr1 A T 7: 29,091,089 probably null Het
Sh3bp2 T A 5: 34,556,947 I162N probably damaging Het
Slc38a10 C T 11: 120,105,392 A960T probably benign Het
Sntb1 C T 15: 55,792,076 C248Y probably damaging Het
Sowahc G A 10: 59,223,227 R395H possibly damaging Het
Tbc1d5 T C 17: 50,813,841 R416G probably benign Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Try5 T C 6: 41,312,427 R72G probably damaging Het
Vwa8 T C 14: 78,982,398 probably null Het
Other mutations in Tnfaip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tnfaip6 APN 2 52055847 missense probably damaging 1.00
IGL01565:Tnfaip6 APN 2 52055834 missense probably damaging 1.00
R0118:Tnfaip6 UTSW 2 52043815 nonsense probably null
R0279:Tnfaip6 UTSW 2 52055916 missense possibly damaging 0.95
R2138:Tnfaip6 UTSW 2 52052332 missense possibly damaging 0.51
R2152:Tnfaip6 UTSW 2 52043730 missense probably damaging 1.00
R2240:Tnfaip6 UTSW 2 52050914 missense probably benign 0.16
R3877:Tnfaip6 UTSW 2 52052327 missense probably benign 0.27
R4235:Tnfaip6 UTSW 2 52050864 missense probably damaging 0.99
R4857:Tnfaip6 UTSW 2 52051074 splice site probably null
R6476:Tnfaip6 UTSW 2 52052316 missense probably benign
R6657:Tnfaip6 UTSW 2 52043783 missense probably damaging 1.00
R7424:Tnfaip6 UTSW 2 52038216 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAACAATAGCCAGGCATG -3'
(R):5'- AGGATTACTTTCTGCTGGAGAGAG -3'

Sequencing Primer
(F):5'- TCCTATTCCAGCAAAGGAGTGTG -3'
(R):5'- CTTTCTGCTGGAGAGAGTAGAAATAC -3'
Posted On2016-11-09