Incidental Mutation 'R5658:Chst5'
ID443931
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Namecarbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
SynonymsGST-4, I-GlcNAc6ST
MMRRC Submission 043172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5658 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111889136-111910447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111890790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 66 (V66A)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
Predicted Effect probably damaging
Transcript: ENSMUST00000034430
AA Change: V66A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: V66A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,447 L221P probably damaging Het
Art2b A G 7: 101,580,362 V110A probably damaging Het
Bccip A G 7: 133,717,620 I147V possibly damaging Het
Bcl9l G T 9: 44,509,169 G1254W probably damaging Het
Cep68 C T 11: 20,241,885 probably null Het
F5 C A 1: 164,192,338 T794K probably damaging Het
Faf2 T C 13: 54,641,534 V55A probably benign Het
Gm7535 T A 17: 17,911,320 probably benign Het
Gm853 A G 4: 130,220,441 V61A probably benign Het
Gm9833 C T 3: 10,088,777 S202F probably damaging Het
Itpr3 T C 17: 27,107,878 V1471A possibly damaging Het
Kbtbd4 T A 2: 90,906,079 S145T probably benign Het
Kcnh3 C T 15: 99,242,076 P948S possibly damaging Het
Kcnq1 G A 7: 143,363,695 probably null Het
Kng2 T C 16: 22,997,020 probably null Het
Krt9 A G 11: 100,190,767 I312T probably damaging Het
Lactb2 T A 1: 13,627,418 H254L probably benign Het
Lama5 A T 2: 180,208,276 Y187* probably null Het
Maf1 T C 15: 76,353,220 V154A possibly damaging Het
Mlh1 A G 9: 111,247,380 V303A probably damaging Het
Mrgprh A T 17: 12,877,759 K295N possibly damaging Het
Mtrr G T 13: 68,568,915 A393D possibly damaging Het
Nebl A G 2: 17,348,852 Y963H probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Pmpcb A G 5: 21,739,001 T78A probably damaging Het
Ptprz1 G A 6: 23,016,189 R1677Q probably damaging Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Ryr1 A T 7: 29,091,089 probably null Het
Sh3bp2 T A 5: 34,556,947 I162N probably damaging Het
Slc38a10 C T 11: 120,105,392 A960T probably benign Het
Sntb1 C T 15: 55,792,076 C248Y probably damaging Het
Sowahc G A 10: 59,223,227 R395H possibly damaging Het
Tbc1d5 T C 17: 50,813,841 R416G probably benign Het
Tnfaip6 A T 2: 52,051,035 Y196F possibly damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Try5 T C 6: 41,312,427 R72G probably damaging Het
Vwa8 T C 14: 78,982,398 probably null Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 111890682 missense probably damaging 1.00
IGL02336:Chst5 APN 8 111890317 missense probably damaging 0.99
IGL02634:Chst5 APN 8 111890845 missense probably damaging 1.00
R0606:Chst5 UTSW 8 111890919 missense probably benign 0.05
R1552:Chst5 UTSW 8 111890280 missense probably damaging 0.99
R2094:Chst5 UTSW 8 111890544 missense probably benign 0.01
R3769:Chst5 UTSW 8 111889881 missense possibly damaging 0.67
R4135:Chst5 UTSW 8 111890184 missense probably damaging 1.00
R4872:Chst5 UTSW 8 111890560 missense possibly damaging 0.61
R5759:Chst5 UTSW 8 111890210 missense probably benign 0.25
R5893:Chst5 UTSW 8 111890196 missense probably damaging 1.00
R6657:Chst5 UTSW 8 111890274 missense probably benign 0.00
R6731:Chst5 UTSW 8 111890044 missense probably benign 0.00
R7406:Chst5 UTSW 8 111890613 missense probably benign 0.00
R7535:Chst5 UTSW 8 111890163 missense probably damaging 1.00
R7727:Chst5 UTSW 8 111890925 missense probably benign 0.25
R7835:Chst5 UTSW 8 111890602 missense probably damaging 1.00
R7843:Chst5 UTSW 8 111890572 missense probably benign 0.00
R8257:Chst5 UTSW 8 111890460 missense probably damaging 1.00
R8324:Chst5 UTSW 8 111890508 missense probably benign 0.06
R8444:Chst5 UTSW 8 111890763 missense probably damaging 1.00
R8458:Chst5 UTSW 8 111890790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTATAGGAGCTGCAGGC -3'
(R):5'- CATGCTTTCGCTCCTGATGG -3'

Sequencing Primer
(F):5'- TTGCGCACAGAGGCTTACAC -3'
(R):5'- TGGTACAGACTGGCATCCTG -3'
Posted On2016-11-09