Incidental Mutation 'R5658:Gm7535'
ID443953
Institutional Source Beutler Lab
Gene Symbol Gm7535
Ensembl Gene ENSMUSG00000090957
Gene Namepredicted gene 7535
Synonyms
MMRRC Submission 043172-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R5658 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17911039-17911947 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 17911320 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000164167]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164167
SMART Domains Protein: ENSMUSP00000125897
Gene: ENSMUSG00000090957

DomainStartEndE-ValueType
Pfam:CNDH2_C 15 292 6.7e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231820
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,447 L221P probably damaging Het
Art2b A G 7: 101,580,362 V110A probably damaging Het
Bccip A G 7: 133,717,620 I147V possibly damaging Het
Bcl9l G T 9: 44,509,169 G1254W probably damaging Het
Cep68 C T 11: 20,241,885 probably null Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
F5 C A 1: 164,192,338 T794K probably damaging Het
Faf2 T C 13: 54,641,534 V55A probably benign Het
Gm853 A G 4: 130,220,441 V61A probably benign Het
Gm9833 C T 3: 10,088,777 S202F probably damaging Het
Itpr3 T C 17: 27,107,878 V1471A possibly damaging Het
Kbtbd4 T A 2: 90,906,079 S145T probably benign Het
Kcnh3 C T 15: 99,242,076 P948S possibly damaging Het
Kcnq1 G A 7: 143,363,695 probably null Het
Kng2 T C 16: 22,997,020 probably null Het
Krt9 A G 11: 100,190,767 I312T probably damaging Het
Lactb2 T A 1: 13,627,418 H254L probably benign Het
Lama5 A T 2: 180,208,276 Y187* probably null Het
Maf1 T C 15: 76,353,220 V154A possibly damaging Het
Mlh1 A G 9: 111,247,380 V303A probably damaging Het
Mrgprh A T 17: 12,877,759 K295N possibly damaging Het
Mtrr G T 13: 68,568,915 A393D possibly damaging Het
Nebl A G 2: 17,348,852 Y963H probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Pmpcb A G 5: 21,739,001 T78A probably damaging Het
Ptprz1 G A 6: 23,016,189 R1677Q probably damaging Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Ryr1 A T 7: 29,091,089 probably null Het
Sh3bp2 T A 5: 34,556,947 I162N probably damaging Het
Slc38a10 C T 11: 120,105,392 A960T probably benign Het
Sntb1 C T 15: 55,792,076 C248Y probably damaging Het
Sowahc G A 10: 59,223,227 R395H possibly damaging Het
Tbc1d5 T C 17: 50,813,841 R416G probably benign Het
Tnfaip6 A T 2: 52,051,035 Y196F possibly damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Try5 T C 6: 41,312,427 R72G probably damaging Het
Vwa8 T C 14: 78,982,398 probably null Het
Other mutations in Gm7535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Gm7535 APN 17 17911888 intron probably benign
IGL01663:Gm7535 APN 17 17911357 intron probably benign
R0165:Gm7535 UTSW 17 17911175 intron probably benign
R0335:Gm7535 UTSW 17 17911112 intron probably benign
R1985:Gm7535 UTSW 17 17911538 intron probably benign
R2217:Gm7535 UTSW 17 17911674 intron probably benign
R2218:Gm7535 UTSW 17 17911674 intron probably benign
R4464:Gm7535 UTSW 17 17911662 intron probably benign
R4581:Gm7535 UTSW 17 17911083 intron probably benign
R4887:Gm7535 UTSW 17 17911071 intron probably benign
R5225:Gm7535 UTSW 17 17911547 intron probably benign
R5305:Gm7535 UTSW 17 17911799 intron probably benign
R5641:Gm7535 UTSW 17 17911526 intron probably benign
R5760:Gm7535 UTSW 17 17911818 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACATTGTGTCCACAGCTGCC -3'
(R):5'- TAGAGCCCGAGGAGTATGTG -3'

Sequencing Primer
(F):5'- CAGTCCTGGCTGCTGAGTGATC -3'
(R):5'- TATGTGGAGGAGCCTGCAG -3'
Posted On2016-11-09