Incidental Mutation 'R5659:Cblc'
ID443975
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission 043303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5659 (G1)
Quality Score200
Status Not validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19792932 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 125 (L125P)
Ref Sequence ENSEMBL: ENSMUSP00000104088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably damaging
Transcript: ENSMUST00000043822
AA Change: L125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: L125P

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108449
AA Change: L125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: L125P

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145755
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,561,050 S105P probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Ap3b2 T A 7: 81,476,752 I367F probably damaging Het
Apaf1 A T 10: 91,062,153 C247* probably null Het
Aqp8 G A 7: 123,466,666 W228* probably null Het
Arhgap32 T A 9: 32,181,960 V178D probably damaging Het
Atp10b T A 11: 43,245,425 W1127R probably damaging Het
Bcl6 A T 16: 23,968,409 C580* probably null Het
Brd1 T C 15: 88,713,381 T568A probably benign Het
Brsk1 C T 7: 4,715,372 P665L possibly damaging Het
Ccdc87 T C 19: 4,840,850 S457P probably damaging Het
Cxcr5 C T 9: 44,513,393 M322I probably benign Het
Cyb5r4 T A 9: 87,055,828 F300Y probably benign Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dhx9 A G 1: 153,471,735 V409A probably damaging Het
Dnah7b A G 1: 46,352,849 D3790G probably damaging Het
Gin1 A G 1: 97,775,532 T27A possibly damaging Het
Gipc1 A T 8: 83,664,126 M287L probably benign Het
Kat6a T A 8: 22,938,160 L1177* probably null Het
Klhl20 A G 1: 161,090,470 V82A probably damaging Het
Kmt2e T C 5: 23,497,807 I995T probably damaging Het
Lpin1 A T 12: 16,540,989 V814E probably damaging Het
Luzp1 T A 4: 136,542,476 V670D probably damaging Het
Lyst C A 13: 13,634,627 A294E possibly damaging Het
Olfr267 A T 4: 58,785,672 F17I probably damaging Het
Olfr3 A T 2: 36,812,954 I46N probably damaging Het
Olfr922 C T 9: 38,815,776 T91I probably benign Het
Olr1 T A 6: 129,500,029 E91V probably damaging Het
Pam T C 1: 97,842,299 Y476C probably damaging Het
Pcdhac1 T C 18: 37,092,417 L761P probably damaging Het
Phf21b C T 15: 84,793,900 W300* probably null Het
Pld2 T C 11: 70,557,561 *945Q probably null Het
Ppp1r37 C T 7: 19,535,523 V145M probably damaging Het
Rasgrf1 T A 9: 89,984,289 N593K probably damaging Het
Rhot1 T G 11: 80,250,355 probably null Het
Rmnd1 A T 10: 4,427,382 M99K probably benign Het
Ros1 G A 10: 52,143,386 T697I possibly damaging Het
Scgb1b10 G T 7: 32,100,878 A4S probably benign Het
Shc3 T C 13: 51,516,594 Y39C probably damaging Het
Slc25a23 A G 17: 57,045,500 probably benign Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Sqor G A 2: 122,787,603 C127Y probably benign Het
Sv2a G C 3: 96,190,303 W467S possibly damaging Het
Togaram2 G T 17: 71,687,672 D39Y probably damaging Het
Tspan11 T A 6: 127,938,277 probably null Het
Usp32 A G 11: 85,077,414 V141A possibly damaging Het
Zbtb38 T C 9: 96,687,420 H537R probably damaging Het
Zfat T C 15: 68,119,013 Y1008C probably damaging Het
Zfp637 G A 6: 117,843,330 G3E probably damaging Het
Zfp788 T A 7: 41,650,116 Y673* probably null Het
Zhx2 T C 15: 57,822,308 S358P probably benign Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
X0028:Cblc UTSW 7 19785273 missense probably benign
Z1177:Cblc UTSW 7 19785278 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAGGAAGAGGCTGTTCTCCC -3'
(R):5'- CCTTCATCGATGAGGAAACAGAG -3'

Sequencing Primer
(F):5'- CCTTGGGCAGGGCAGTTAAG -3'
(R):5'- TTTGCACCTGTAGGGACT -3'
Posted On2016-11-09