Incidental Mutation 'R5659:Kat6a'
ID443981
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission 043303-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5659 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22938160 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1177 (L1177*)
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect probably null
Transcript: ENSMUST00000044331
AA Change: L1177*
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: L1177*

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110696
AA Change: L1177*
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: L1177*

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,561,050 S105P probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Ap3b2 T A 7: 81,476,752 I367F probably damaging Het
Apaf1 A T 10: 91,062,153 C247* probably null Het
Aqp8 G A 7: 123,466,666 W228* probably null Het
Arhgap32 T A 9: 32,181,960 V178D probably damaging Het
Atp10b T A 11: 43,245,425 W1127R probably damaging Het
Bcl6 A T 16: 23,968,409 C580* probably null Het
Brd1 T C 15: 88,713,381 T568A probably benign Het
Brsk1 C T 7: 4,715,372 P665L possibly damaging Het
Cblc A G 7: 19,792,932 L125P probably damaging Het
Ccdc87 T C 19: 4,840,850 S457P probably damaging Het
Cxcr5 C T 9: 44,513,393 M322I probably benign Het
Cyb5r4 T A 9: 87,055,828 F300Y probably benign Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dhx9 A G 1: 153,471,735 V409A probably damaging Het
Dnah7b A G 1: 46,352,849 D3790G probably damaging Het
Gin1 A G 1: 97,775,532 T27A possibly damaging Het
Gipc1 A T 8: 83,664,126 M287L probably benign Het
Klhl20 A G 1: 161,090,470 V82A probably damaging Het
Kmt2e T C 5: 23,497,807 I995T probably damaging Het
Lpin1 A T 12: 16,540,989 V814E probably damaging Het
Luzp1 T A 4: 136,542,476 V670D probably damaging Het
Lyst C A 13: 13,634,627 A294E possibly damaging Het
Olfr267 A T 4: 58,785,672 F17I probably damaging Het
Olfr3 A T 2: 36,812,954 I46N probably damaging Het
Olfr922 C T 9: 38,815,776 T91I probably benign Het
Olr1 T A 6: 129,500,029 E91V probably damaging Het
Pam T C 1: 97,842,299 Y476C probably damaging Het
Pcdhac1 T C 18: 37,092,417 L761P probably damaging Het
Phf21b C T 15: 84,793,900 W300* probably null Het
Pld2 T C 11: 70,557,561 *945Q probably null Het
Ppp1r37 C T 7: 19,535,523 V145M probably damaging Het
Rasgrf1 T A 9: 89,984,289 N593K probably damaging Het
Rhot1 T G 11: 80,250,355 probably null Het
Rmnd1 A T 10: 4,427,382 M99K probably benign Het
Ros1 G A 10: 52,143,386 T697I possibly damaging Het
Scgb1b10 G T 7: 32,100,878 A4S probably benign Het
Shc3 T C 13: 51,516,594 Y39C probably damaging Het
Slc25a23 A G 17: 57,045,500 probably benign Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Sqor G A 2: 122,787,603 C127Y probably benign Het
Sv2a G C 3: 96,190,303 W467S possibly damaging Het
Togaram2 G T 17: 71,687,672 D39Y probably damaging Het
Tspan11 T A 6: 127,938,277 probably null Het
Usp32 A G 11: 85,077,414 V141A possibly damaging Het
Zbtb38 T C 9: 96,687,420 H537R probably damaging Het
Zfat T C 15: 68,119,013 Y1008C probably damaging Het
Zfp637 G A 6: 117,843,330 G3E probably damaging Het
Zfp788 T A 7: 41,650,116 Y673* probably null Het
Zhx2 T C 15: 57,822,308 S358P probably benign Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3724:Kat6a UTSW 8 22862788 missense probably damaging 0.99
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5279:Kat6a UTSW 8 22939648 small deletion probably benign
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6223:Kat6a UTSW 8 22940426 missense unknown
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R6913:Kat6a UTSW 8 22903199 missense possibly damaging 0.53
R7047:Kat6a UTSW 8 22938538 missense possibly damaging 0.53
R7235:Kat6a UTSW 8 22914269 missense possibly damaging 0.94
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
R7454:Kat6a UTSW 8 22935772 missense possibly damaging 0.56
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCTGTCCTAAAGCCAGTATC -3'
(R):5'- CTGTTGCTGCTGTCCAATGG -3'

Sequencing Primer
(F):5'- GCCAGTATCTCTCTTGCGAAAATGTG -3'
(R):5'- ACATGGCTCTAATGTCACTGCTGG -3'
Posted On2016-11-09