Incidental Mutation 'R5659:Zbtb38'
ID443989
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Namezinc finger and BTB domain containing 38
SynonymsCIBZ, A930014K01Rik, Zenon homolog
MMRRC Submission 043303-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R5659 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location96682770-96752831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96687420 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 537 (H537R)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: H537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: H537R

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126066
AA Change: H537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: H537R

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140121
AA Change: H537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433
AA Change: H537R

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: H537R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: H537R

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,561,050 S105P probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Ap3b2 T A 7: 81,476,752 I367F probably damaging Het
Apaf1 A T 10: 91,062,153 C247* probably null Het
Aqp8 G A 7: 123,466,666 W228* probably null Het
Arhgap32 T A 9: 32,181,960 V178D probably damaging Het
Atp10b T A 11: 43,245,425 W1127R probably damaging Het
Bcl6 A T 16: 23,968,409 C580* probably null Het
Brd1 T C 15: 88,713,381 T568A probably benign Het
Brsk1 C T 7: 4,715,372 P665L possibly damaging Het
Cblc A G 7: 19,792,932 L125P probably damaging Het
Ccdc87 T C 19: 4,840,850 S457P probably damaging Het
Cxcr5 C T 9: 44,513,393 M322I probably benign Het
Cyb5r4 T A 9: 87,055,828 F300Y probably benign Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dhx9 A G 1: 153,471,735 V409A probably damaging Het
Dnah7b A G 1: 46,352,849 D3790G probably damaging Het
Gin1 A G 1: 97,775,532 T27A possibly damaging Het
Gipc1 A T 8: 83,664,126 M287L probably benign Het
Kat6a T A 8: 22,938,160 L1177* probably null Het
Klhl20 A G 1: 161,090,470 V82A probably damaging Het
Kmt2e T C 5: 23,497,807 I995T probably damaging Het
Lpin1 A T 12: 16,540,989 V814E probably damaging Het
Luzp1 T A 4: 136,542,476 V670D probably damaging Het
Lyst C A 13: 13,634,627 A294E possibly damaging Het
Olfr267 A T 4: 58,785,672 F17I probably damaging Het
Olfr3 A T 2: 36,812,954 I46N probably damaging Het
Olfr922 C T 9: 38,815,776 T91I probably benign Het
Olr1 T A 6: 129,500,029 E91V probably damaging Het
Pam T C 1: 97,842,299 Y476C probably damaging Het
Pcdhac1 T C 18: 37,092,417 L761P probably damaging Het
Phf21b C T 15: 84,793,900 W300* probably null Het
Pld2 T C 11: 70,557,561 *945Q probably null Het
Ppp1r37 C T 7: 19,535,523 V145M probably damaging Het
Rasgrf1 T A 9: 89,984,289 N593K probably damaging Het
Rhot1 T G 11: 80,250,355 probably null Het
Rmnd1 A T 10: 4,427,382 M99K probably benign Het
Ros1 G A 10: 52,143,386 T697I possibly damaging Het
Scgb1b10 G T 7: 32,100,878 A4S probably benign Het
Shc3 T C 13: 51,516,594 Y39C probably damaging Het
Slc25a23 A G 17: 57,045,500 probably benign Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Sqor G A 2: 122,787,603 C127Y probably benign Het
Sv2a G C 3: 96,190,303 W467S possibly damaging Het
Togaram2 G T 17: 71,687,672 D39Y probably damaging Het
Tspan11 T A 6: 127,938,277 probably null Het
Usp32 A G 11: 85,077,414 V141A possibly damaging Het
Zfat T C 15: 68,119,013 Y1008C probably damaging Het
Zfp637 G A 6: 117,843,330 G3E probably damaging Het
Zfp788 T A 7: 41,650,116 Y673* probably null Het
Zhx2 T C 15: 57,822,308 S358P probably benign Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96687494 missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96688408 missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96687073 missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96686619 missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96687174 missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96686316 missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96687676 missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96686280 missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96686940 missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96685773 missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96685954 missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96686991 missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96685462 missense probably benign
R1772:Zbtb38 UTSW 9 96688041 missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96688881 missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96686995 missense probably benign
R2446:Zbtb38 UTSW 9 96687646 missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96688249 missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96687546 missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96686102 small deletion probably benign
R4630:Zbtb38 UTSW 9 96688851 missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96688383 missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96688201 missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96685651 missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96687009 missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96687108 missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96687643 missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96685992 missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96687229 missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96686654 nonsense probably null
R6625:Zbtb38 UTSW 9 96687313 missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96686464 missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96687427 missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96685541 missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96685976 nonsense probably null
R7900:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
R7983:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96687612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCATTTCAGAGCTTTGC -3'
(R):5'- TTCACTCGTGGAGAAGAACATACC -3'

Sequencing Primer
(F):5'- TCAGAGCTTTGCAGATTCGGAAC -3'
(R):5'- TCGTGGAGAAGAACATACCCTTGC -3'
Posted On2016-11-09