Incidental Mutation 'R5659:Bcl6'
ID 444005
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene Name B cell leukemia/lymphoma 6
Synonyms Bcl5
MMRRC Submission 043303-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R5659 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 23783802-23807602 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 23787159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 580 (C580*)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
AlphaFold P41183
Predicted Effect probably null
Transcript: ENSMUST00000023151
AA Change: C580*
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: C580*

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135352
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,694,103 (GRCm39) S105P probably damaging Het
Ano5 G A 7: 51,233,562 (GRCm39) R658H possibly damaging Het
Ap3b2 T A 7: 81,126,500 (GRCm39) I367F probably damaging Het
Apaf1 A T 10: 90,898,015 (GRCm39) C247* probably null Het
Aqp8 G A 7: 123,065,889 (GRCm39) W228* probably null Het
Arhgap32 T A 9: 32,093,256 (GRCm39) V178D probably damaging Het
Atp10b T A 11: 43,136,252 (GRCm39) W1127R probably damaging Het
Brd1 T C 15: 88,597,584 (GRCm39) T568A probably benign Het
Brsk1 C T 7: 4,718,371 (GRCm39) P665L possibly damaging Het
Cblc A G 7: 19,526,857 (GRCm39) L125P probably damaging Het
Ccdc87 T C 19: 4,890,878 (GRCm39) S457P probably damaging Het
Cxcr5 C T 9: 44,424,690 (GRCm39) M322I probably benign Het
Cyb5r4 T A 9: 86,937,881 (GRCm39) F300Y probably benign Het
Cyp3a25 T C 5: 145,928,356 (GRCm39) T230A possibly damaging Het
Dhx9 A G 1: 153,347,481 (GRCm39) V409A probably damaging Het
Dnah7b A G 1: 46,392,009 (GRCm39) D3790G probably damaging Het
Gin1 A G 1: 97,703,257 (GRCm39) T27A possibly damaging Het
Gipc1 A T 8: 84,390,755 (GRCm39) M287L probably benign Het
Kat6a T A 8: 23,428,176 (GRCm39) L1177* probably null Het
Klhl20 A G 1: 160,918,040 (GRCm39) V82A probably damaging Het
Kmt2e T C 5: 23,702,805 (GRCm39) I995T probably damaging Het
Lpin1 A T 12: 16,590,990 (GRCm39) V814E probably damaging Het
Luzp1 T A 4: 136,269,787 (GRCm39) V670D probably damaging Het
Lyst C A 13: 13,809,212 (GRCm39) A294E possibly damaging Het
Olr1 T A 6: 129,476,992 (GRCm39) E91V probably damaging Het
Or1j1 A T 2: 36,702,966 (GRCm39) I46N probably damaging Het
Or2k2 A T 4: 58,785,672 (GRCm39) F17I probably damaging Het
Or8b55 C T 9: 38,727,072 (GRCm39) T91I probably benign Het
Pam T C 1: 97,770,024 (GRCm39) Y476C probably damaging Het
Pcdhac1 T C 18: 37,225,470 (GRCm39) L761P probably damaging Het
Phf21b C T 15: 84,678,101 (GRCm39) W300* probably null Het
Pld2 T C 11: 70,448,387 (GRCm39) *945Q probably null Het
Ppp1r37 C T 7: 19,269,448 (GRCm39) V145M probably damaging Het
Rasgrf1 T A 9: 89,866,342 (GRCm39) N593K probably damaging Het
Rhot1 T G 11: 80,141,181 (GRCm39) probably null Het
Rmnd1 A T 10: 4,377,382 (GRCm39) M99K probably benign Het
Ros1 G A 10: 52,019,482 (GRCm39) T697I possibly damaging Het
Scgb1b10 G T 7: 31,800,303 (GRCm39) A4S probably benign Het
Shc3 T C 13: 51,670,630 (GRCm39) Y39C probably damaging Het
Slc25a23 A G 17: 57,352,500 (GRCm39) probably benign Het
Slc5a8 C T 10: 88,755,290 (GRCm39) L466F possibly damaging Het
Sqor G A 2: 122,629,523 (GRCm39) C127Y probably benign Het
Sv2a G C 3: 96,097,619 (GRCm39) W467S possibly damaging Het
Togaram2 G T 17: 71,994,667 (GRCm39) D39Y probably damaging Het
Tspan11 T A 6: 127,915,240 (GRCm39) probably null Het
Usp32 A G 11: 84,968,240 (GRCm39) V141A possibly damaging Het
Zbtb38 T C 9: 96,569,473 (GRCm39) H537R probably damaging Het
Zfat T C 15: 67,990,862 (GRCm39) Y1008C probably damaging Het
Zfp637 G A 6: 117,820,291 (GRCm39) G3E probably damaging Het
Zfp788 T A 7: 41,299,540 (GRCm39) Y673* probably null Het
Zhx2 T C 15: 57,685,704 (GRCm39) S358P probably benign Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23,793,641 (GRCm39) missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23,796,319 (GRCm39) missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23,793,788 (GRCm39) splice site probably benign
IGL03271:Bcl6 APN 16 23,788,756 (GRCm39) missense probably benign 0.00
Adriatic UTSW 16 23,786,883 (GRCm39) missense probably damaging 0.99
Catanzaro UTSW 16 23,784,976 (GRCm39) nonsense probably null
Density UTSW 16 23,788,798 (GRCm39) missense possibly damaging 0.91
nouvelle UTSW 16 23,788,736 (GRCm39) missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23,784,969 (GRCm39) missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23,791,344 (GRCm39) missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23,786,889 (GRCm39) missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23,784,905 (GRCm39) missense probably benign
R1134:Bcl6 UTSW 16 23,787,115 (GRCm39) missense probably benign
R1317:Bcl6 UTSW 16 23,796,292 (GRCm39) missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23,791,097 (GRCm39) missense probably benign 0.02
R1393:Bcl6 UTSW 16 23,796,316 (GRCm39) missense probably damaging 0.99
R1761:Bcl6 UTSW 16 23,796,292 (GRCm39) missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23,793,680 (GRCm39) missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23,791,382 (GRCm39) nonsense probably null
R2293:Bcl6 UTSW 16 23,796,359 (GRCm39) missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23,786,869 (GRCm39) missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23,796,304 (GRCm39) missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23,787,203 (GRCm39) intron probably benign
R5015:Bcl6 UTSW 16 23,793,600 (GRCm39) missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23,791,496 (GRCm39) missense probably benign
R5185:Bcl6 UTSW 16 23,791,697 (GRCm39) missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23,788,736 (GRCm39) missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23,791,926 (GRCm39) missense probably benign 0.01
R5909:Bcl6 UTSW 16 23,791,556 (GRCm39) missense probably benign
R6384:Bcl6 UTSW 16 23,793,615 (GRCm39) missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23,793,611 (GRCm39) missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23,791,364 (GRCm39) missense possibly damaging 0.94
R7122:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7154:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7155:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7156:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7163:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7164:Bcl6 UTSW 16 23,784,976 (GRCm39) nonsense probably null
R7434:Bcl6 UTSW 16 23,788,798 (GRCm39) missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23,790,163 (GRCm39) critical splice donor site probably null
R7914:Bcl6 UTSW 16 23,788,761 (GRCm39) missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23,791,652 (GRCm39) missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23,786,883 (GRCm39) missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23,791,698 (GRCm39) missense probably benign 0.39
R8951:Bcl6 UTSW 16 23,793,704 (GRCm39) missense probably damaging 1.00
R8956:Bcl6 UTSW 16 23,793,716 (GRCm39) missense probably damaging 0.99
R9401:Bcl6 UTSW 16 23,791,107 (GRCm39) missense possibly damaging 0.77
R9471:Bcl6 UTSW 16 23,791,857 (GRCm39) missense probably benign 0.32
Z1176:Bcl6 UTSW 16 23,788,708 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACGGCTTCTCTCCAGTGTG -3'
(R):5'- GACCTTGTCCCTTGCAATGTG -3'

Sequencing Primer
(F):5'- TCCAGTGTGGATGAGCACG -3'
(R):5'- CTAGATCAGTGGTTCTCAGCCAG -3'
Posted On 2016-11-09