Incidental Mutation 'R5660:Adamts13'
ID444016
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 043173-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5660 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26996749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 966 (V966A)
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]
Predicted Effect probably benign
Transcript: ENSMUST00000014996
AA Change: V966A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: V966A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 2.3e-11 PFAM
Pfam:Reprolysin 84 291 1e-15 PFAM
Pfam:Reprolysin_3 113 237 2e-10 PFAM
Pfam:Reprolysin_2 132 281 5e-9 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102891
AA Change: V966A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: V966A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,404 N1307S probably benign Het
Abcf1 A T 17: 35,963,647 D41E possibly damaging Het
Adamts2 A T 11: 50,776,645 D470V probably damaging Het
Adar T C 3: 89,735,594 F261L probably damaging Het
Akap3 C T 6: 126,865,291 A291V probably damaging Het
Akr1c6 G A 13: 4,449,054 V214I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Arhgap11a T A 2: 113,841,910 I238F possibly damaging Het
Atg2b A T 12: 105,649,124 Y1024* probably null Het
Cad T A 5: 31,076,847 D1956E probably damaging Het
Cbs A T 17: 31,624,246 I237N probably damaging Het
Ccdc81 T C 7: 89,893,129 T180A probably benign Het
Cftr T A 6: 18,313,687 N1303K probably benign Het
Col6a4 A G 9: 105,996,116 S2227P probably benign Het
Crebbp A T 16: 4,154,858 M324K possibly damaging Het
Dst A G 1: 34,282,493 K4363R probably damaging Het
Eif2b4 A T 5: 31,191,156 Y238N probably benign Het
Fam83c G A 2: 155,829,589 A642V probably benign Het
Fat2 T A 11: 55,284,176 T1904S probably benign Het
Flt3 T C 5: 147,369,481 N279S possibly damaging Het
Galnt4 A G 10: 99,109,535 N374S probably benign Het
Gm14401 T A 2: 177,086,431 H103Q probably damaging Het
Gm5422 A T 10: 31,250,052 noncoding transcript Het
Helb G A 10: 120,111,079 Q110* probably null Het
Ido1 T C 8: 24,591,542 D41G probably damaging Het
Igfn1 A G 1: 135,970,414 S805P probably benign Het
Matr3 C A 18: 35,572,094 A24E probably damaging Het
Mmp23 C T 4: 155,651,253 C287Y probably damaging Het
Mrnip A G 11: 50,197,091 R147G probably null Het
Msh6 A G 17: 87,984,719 K301E possibly damaging Het
Olfr103 A G 17: 37,336,644 L196P probably damaging Het
Olfr967 G A 9: 39,750,767 C127Y probably damaging Het
Ptar1 T A 19: 23,694,412 C60S probably benign Het
Rora A G 9: 68,653,921 S11G probably benign Het
Rps6ka5 G T 12: 100,619,580 H151Q possibly damaging Het
Sgsh A G 11: 119,350,981 S100P probably damaging Het
Simc1 A G 13: 54,547,089 T1229A probably benign Het
Slc26a11 T C 11: 119,357,978 Y62H probably damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Smg1 C T 7: 118,143,347 V3215I probably benign Het
Smyd2 G A 1: 189,885,382 P285L possibly damaging Het
Themis2 T C 4: 132,796,256 probably null Het
Tln1 A G 4: 43,547,732 V743A probably damaging Het
Tpo T A 12: 30,100,496 N462Y possibly damaging Het
Wnt2 T A 6: 18,028,146 M30L probably benign Het
Zfyve9 T C 4: 108,719,168 I239V probably benign Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
R8076:Adamts13 UTSW 2 26990612 missense probably benign 0.06
R8245:Adamts13 UTSW 2 26990556 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTCAAAATGCCTGTCCAG -3'
(R):5'- TAATACAGATCCATGGCTGCC -3'

Sequencing Primer
(F):5'- CTGTCCAGGAAGAGCTATGC -3'
(R):5'- TATCTCCCAGGCAAGGTACTC -3'
Posted On2016-11-09