Incidental Mutation 'R5660:Rps6ka5'
ID444050
Institutional Source Beutler Lab
Gene Symbol Rps6ka5
Ensembl Gene ENSMUSG00000021180
Gene Nameribosomal protein S6 kinase, polypeptide 5
Synonyms6330404E13Rik, MSK1, 3110005L17Rik
MMRRC Submission 043173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5660 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location100548439-100726983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100619580 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 151 (H151Q)
Ref Sequence ENSEMBL: ENSMUSP00000152481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043599] [ENSMUST00000222731]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043599
AA Change: H151Q

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042987
Gene: ENSMUSG00000021180
AA Change: H151Q

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
S_TKc 48 317 1.08e-101 SMART
S_TK_X 318 378 2.45e-13 SMART
S_TKc 425 751 1.1e-75 SMART
low complexity region 812 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222512
Predicted Effect possibly damaging
Transcript: ENSMUST00000222731
AA Change: H151Q

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutant allele exhibit altered response to cocaine including decreased hyperlocomotor activity and sensitization at a lower dose. Mice homozygous for a kinase dead allele exhibit altered experience-dependent synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,404 N1307S probably benign Het
Abcf1 A T 17: 35,963,647 D41E possibly damaging Het
Adamts13 T C 2: 26,996,749 V966A probably benign Het
Adamts2 A T 11: 50,776,645 D470V probably damaging Het
Adar T C 3: 89,735,594 F261L probably damaging Het
Akap3 C T 6: 126,865,291 A291V probably damaging Het
Akr1c6 G A 13: 4,449,054 V214I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Arhgap11a T A 2: 113,841,910 I238F possibly damaging Het
Atg2b A T 12: 105,649,124 Y1024* probably null Het
Cad T A 5: 31,076,847 D1956E probably damaging Het
Cbs A T 17: 31,624,246 I237N probably damaging Het
Ccdc81 T C 7: 89,893,129 T180A probably benign Het
Cftr T A 6: 18,313,687 N1303K probably benign Het
Col6a4 A G 9: 105,996,116 S2227P probably benign Het
Crebbp A T 16: 4,154,858 M324K possibly damaging Het
Dst A G 1: 34,282,493 K4363R probably damaging Het
Eif2b4 A T 5: 31,191,156 Y238N probably benign Het
Fam83c G A 2: 155,829,589 A642V probably benign Het
Fat2 T A 11: 55,284,176 T1904S probably benign Het
Flt3 T C 5: 147,369,481 N279S possibly damaging Het
Galnt4 A G 10: 99,109,535 N374S probably benign Het
Gm14401 T A 2: 177,086,431 H103Q probably damaging Het
Gm5422 A T 10: 31,250,052 noncoding transcript Het
Helb G A 10: 120,111,079 Q110* probably null Het
Ido1 T C 8: 24,591,542 D41G probably damaging Het
Igfn1 A G 1: 135,970,414 S805P probably benign Het
Matr3 C A 18: 35,572,094 A24E probably damaging Het
Mmp23 C T 4: 155,651,253 C287Y probably damaging Het
Mrnip A G 11: 50,197,091 R147G probably null Het
Msh6 A G 17: 87,984,719 K301E possibly damaging Het
Olfr103 A G 17: 37,336,644 L196P probably damaging Het
Olfr967 G A 9: 39,750,767 C127Y probably damaging Het
Ptar1 T A 19: 23,694,412 C60S probably benign Het
Rora A G 9: 68,653,921 S11G probably benign Het
Sgsh A G 11: 119,350,981 S100P probably damaging Het
Simc1 A G 13: 54,547,089 T1229A probably benign Het
Slc26a11 T C 11: 119,357,978 Y62H probably damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Smg1 C T 7: 118,143,347 V3215I probably benign Het
Smyd2 G A 1: 189,885,382 P285L possibly damaging Het
Themis2 T C 4: 132,796,256 probably null Het
Tln1 A G 4: 43,547,732 V743A probably damaging Het
Tpo T A 12: 30,100,496 N462Y possibly damaging Het
Wnt2 T A 6: 18,028,146 M30L probably benign Het
Zfyve9 T C 4: 108,719,168 I239V probably benign Het
Other mutations in Rps6ka5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rps6ka5 APN 12 100573898 missense probably benign
IGL01450:Rps6ka5 APN 12 100552991 splice site probably benign
IGL01586:Rps6ka5 APN 12 100570914 missense probably damaging 0.99
IGL01743:Rps6ka5 APN 12 100575633 critical splice donor site probably null
IGL02995:Rps6ka5 APN 12 100573999 intron probably benign
IGL03051:Rps6ka5 APN 12 100615991 splice site probably null
IGL03190:Rps6ka5 APN 12 100558648 splice site probably benign
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0055:Rps6ka5 UTSW 12 100678580 missense probably damaging 0.97
R0067:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R0212:Rps6ka5 UTSW 12 100553169 splice site probably null
R0761:Rps6ka5 UTSW 12 100570882 missense probably damaging 1.00
R0893:Rps6ka5 UTSW 12 100574438 missense possibly damaging 0.71
R1237:Rps6ka5 UTSW 12 100575705 missense possibly damaging 0.85
R1254:Rps6ka5 UTSW 12 100619529 missense probably damaging 1.00
R1447:Rps6ka5 UTSW 12 100577825 missense probably benign 0.02
R1611:Rps6ka5 UTSW 12 100570852 missense possibly damaging 0.77
R2086:Rps6ka5 UTSW 12 100619615 missense possibly damaging 0.67
R2129:Rps6ka5 UTSW 12 100678538 missense probably damaging 0.99
R2298:Rps6ka5 UTSW 12 100551454 missense probably damaging 0.99
R2432:Rps6ka5 UTSW 12 100554405 missense probably damaging 0.98
R4378:Rps6ka5 UTSW 12 100597937 missense probably damaging 1.00
R4394:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4461:Rps6ka5 UTSW 12 100570864 missense probably damaging 0.99
R4584:Rps6ka5 UTSW 12 100581318 missense probably damaging 1.00
R4672:Rps6ka5 UTSW 12 100654287 missense possibly damaging 0.93
R4706:Rps6ka5 UTSW 12 100581319 missense probably damaging 0.97
R4706:Rps6ka5 UTSW 12 100597885 splice site probably null
R4707:Rps6ka5 UTSW 12 100597885 splice site probably null
R4966:Rps6ka5 UTSW 12 100553066 missense probably benign 0.01
R5059:Rps6ka5 UTSW 12 100554375 missense probably damaging 0.96
R5404:Rps6ka5 UTSW 12 100616093 missense probably damaging 1.00
R5678:Rps6ka5 UTSW 12 100724876 missense unknown
R5992:Rps6ka5 UTSW 12 100575250 missense possibly damaging 0.68
R6104:Rps6ka5 UTSW 12 100553148 missense possibly damaging 0.84
R6163:Rps6ka5 UTSW 12 100595920 critical splice acceptor site probably null
R6390:Rps6ka5 UTSW 12 100570992 missense probably damaging 0.99
R6599:Rps6ka5 UTSW 12 100597909 missense probably damaging 1.00
R6653:Rps6ka5 UTSW 12 100551536 missense probably damaging 1.00
R6693:Rps6ka5 UTSW 12 100573829 missense probably benign 0.11
R7009:Rps6ka5 UTSW 12 100619537 missense probably damaging 1.00
R7157:Rps6ka5 UTSW 12 100581420 missense probably damaging 1.00
R7196:Rps6ka5 UTSW 12 100595864 missense possibly damaging 0.77
R7510:Rps6ka5 UTSW 12 100616068 missense possibly damaging 0.56
R7565:Rps6ka5 UTSW 12 100616083 missense probably damaging 1.00
R7800:Rps6ka5 UTSW 12 100558565 missense probably damaging 0.97
R7843:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R7926:Rps6ka5 UTSW 12 100553149 missense possibly damaging 0.92
R8009:Rps6ka5 UTSW 12 100577789 missense probably damaging 0.97
R8057:Rps6ka5 UTSW 12 100573796 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGAGAACAGTAACATTCATAAGCC -3'
(R):5'- TCCTTGCACATTAATCTGGTTTGG -3'

Sequencing Primer
(F):5'- CCAAGGCAACGTGTGGAAACATC -3'
(R):5'- CACATTAATCTGGTTTGGTTAGGATG -3'
Posted On2016-11-09