Incidental Mutation 'R5660:Akr1c6'
ID444052
Institutional Source Beutler Lab
Gene Symbol Akr1c6
Ensembl Gene ENSMUSG00000021210
Gene Namealdo-keto reductase family 1, member C6
Synonyms3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Hsd17b5, Akr1c1
MMRRC Submission 043173-MU
Accession Numbers

Genbank: NM_030611; MGI: 1933427

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5660 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location4434306-4457877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4449054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 214 (V214I)
Ref Sequence ENSEMBL: ENSMUSP00000021630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021630] [ENSMUST00000156277] [ENSMUST00000220941] [ENSMUST00000223118]
Predicted Effect probably benign
Transcript: ENSMUST00000021630
AA Change: V214I

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021630
Gene: ENSMUSG00000021210
AA Change: V214I

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156277
AA Change: V161I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117624
Gene: ENSMUSG00000021210
AA Change: V161I

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 173 3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220941
Predicted Effect probably benign
Transcript: ENSMUST00000223118
AA Change: V36I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,404 N1307S probably benign Het
Abcf1 A T 17: 35,963,647 D41E possibly damaging Het
Adamts13 T C 2: 26,996,749 V966A probably benign Het
Adamts2 A T 11: 50,776,645 D470V probably damaging Het
Adar T C 3: 89,735,594 F261L probably damaging Het
Akap3 C T 6: 126,865,291 A291V probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Arhgap11a T A 2: 113,841,910 I238F possibly damaging Het
Atg2b A T 12: 105,649,124 Y1024* probably null Het
Cad T A 5: 31,076,847 D1956E probably damaging Het
Cbs A T 17: 31,624,246 I237N probably damaging Het
Ccdc81 T C 7: 89,893,129 T180A probably benign Het
Cftr T A 6: 18,313,687 N1303K probably benign Het
Col6a4 A G 9: 105,996,116 S2227P probably benign Het
Crebbp A T 16: 4,154,858 M324K possibly damaging Het
Dst A G 1: 34,282,493 K4363R probably damaging Het
Eif2b4 A T 5: 31,191,156 Y238N probably benign Het
Fam83c G A 2: 155,829,589 A642V probably benign Het
Fat2 T A 11: 55,284,176 T1904S probably benign Het
Flt3 T C 5: 147,369,481 N279S possibly damaging Het
Galnt4 A G 10: 99,109,535 N374S probably benign Het
Gm14401 T A 2: 177,086,431 H103Q probably damaging Het
Gm5422 A T 10: 31,250,052 noncoding transcript Het
Helb G A 10: 120,111,079 Q110* probably null Het
Ido1 T C 8: 24,591,542 D41G probably damaging Het
Igfn1 A G 1: 135,970,414 S805P probably benign Het
Matr3 C A 18: 35,572,094 A24E probably damaging Het
Mmp23 C T 4: 155,651,253 C287Y probably damaging Het
Mrnip A G 11: 50,197,091 R147G probably null Het
Msh6 A G 17: 87,984,719 K301E possibly damaging Het
Olfr103 A G 17: 37,336,644 L196P probably damaging Het
Olfr967 G A 9: 39,750,767 C127Y probably damaging Het
Ptar1 T A 19: 23,694,412 C60S probably benign Het
Rora A G 9: 68,653,921 S11G probably benign Het
Rps6ka5 G T 12: 100,619,580 H151Q possibly damaging Het
Sgsh A G 11: 119,350,981 S100P probably damaging Het
Simc1 A G 13: 54,547,089 T1229A probably benign Het
Slc26a11 T C 11: 119,357,978 Y62H probably damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Smg1 C T 7: 118,143,347 V3215I probably benign Het
Smyd2 G A 1: 189,885,382 P285L possibly damaging Het
Themis2 T C 4: 132,796,256 probably null Het
Tln1 A G 4: 43,547,732 V743A probably damaging Het
Tpo T A 12: 30,100,496 N462Y possibly damaging Het
Wnt2 T A 6: 18,028,146 M30L probably benign Het
Zfyve9 T C 4: 108,719,168 I239V probably benign Het
Other mutations in Akr1c6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Akr1c6 APN 13 4448978 splice site probably benign
IGL01838:Akr1c6 APN 13 4449036 missense probably benign 0.44
IGL02318:Akr1c6 APN 13 4438497 missense probably benign 0.05
IGL02986:Akr1c6 APN 13 4436415 missense probably benign 0.42
IGL03168:Akr1c6 APN 13 4436281 missense probably benign 0.04
IGL03190:Akr1c6 APN 13 4446413 missense possibly damaging 0.49
IGL03258:Akr1c6 APN 13 4436409 missense probably damaging 1.00
R0940:Akr1c6 UTSW 13 4436373 missense probably benign 0.42
R1442:Akr1c6 UTSW 13 4457160 missense probably damaging 1.00
R1624:Akr1c6 UTSW 13 4446364 missense probably benign
R1937:Akr1c6 UTSW 13 4446384 missense probably benign 0.01
R2392:Akr1c6 UTSW 13 4434478 splice site probably null
R2398:Akr1c6 UTSW 13 4449036 missense probably benign 0.44
R4655:Akr1c6 UTSW 13 4449429 missense probably damaging 0.98
R4761:Akr1c6 UTSW 13 4447011 missense probably benign 0.01
R4913:Akr1c6 UTSW 13 4454525 missense probably benign 0.18
R4923:Akr1c6 UTSW 13 4454495 missense probably damaging 1.00
R4953:Akr1c6 UTSW 13 4438609 splice site probably null
R5255:Akr1c6 UTSW 13 4447019 missense probably benign 0.20
R5452:Akr1c6 UTSW 13 4454545 missense probably benign 0.00
R6242:Akr1c6 UTSW 13 4436362 missense probably benign 0.01
R6323:Akr1c6 UTSW 13 4447018 missense possibly damaging 0.91
R6599:Akr1c6 UTSW 13 4449319 unclassified probably null
R6847:Akr1c6 UTSW 13 4438498 nonsense probably null
R6989:Akr1c6 UTSW 13 4449046 missense probably damaging 1.00
R7003:Akr1c6 UTSW 13 4454515 missense probably benign 0.14
R7251:Akr1c6 UTSW 13 4447020 missense probably damaging 1.00
R7310:Akr1c6 UTSW 13 4436355 missense probably benign
X0062:Akr1c6 UTSW 13 4438535 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCACTATGTGCAATGAATACAAGACA -3'
(R):5'- GGTTGATAAAGCCATTGTGGTTT -3'

Sequencing Primer
(F):5'- GCAATCCAATACACTGGGTTATGGC -3'
(R):5'- AAAGCCATTGTGGTTTTTATTCTCC -3'
Posted On2016-11-09