Incidental Mutation 'R5660:Ptar1'
ID 444061
Institutional Source Beutler Lab
Gene Symbol Ptar1
Ensembl Gene ENSMUSG00000074925
Gene Name protein prenyltransferase alpha subunit repeat containing 1
Synonyms 4930428J16Rik, 2010013L17Rik, 1700084D09Rik
MMRRC Submission 043173-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R5660 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 23664793-23709032 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23671776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 60 (C60S)
Ref Sequence ENSEMBL: ENSMUSP00000097156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099560]
AlphaFold A0A494B9V8
Predicted Effect probably benign
Transcript: ENSMUST00000099560
AA Change: C60S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097156
Gene: ENSMUSG00000074925
AA Change: C60S

DomainStartEndE-ValueType
Pfam:PPTA 122 149 3.9e-8 PFAM
Pfam:PPTA 180 207 5e-11 PFAM
Pfam:PPTA 290 315 8e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,757,828 (GRCm39) N1307S probably benign Het
Abcf1 A T 17: 36,274,539 (GRCm39) D41E possibly damaging Het
Adamts13 T C 2: 26,886,761 (GRCm39) V966A probably benign Het
Adamts2 A T 11: 50,667,472 (GRCm39) D470V probably damaging Het
Adar T C 3: 89,642,901 (GRCm39) F261L probably damaging Het
Akap3 C T 6: 126,842,254 (GRCm39) A291V probably damaging Het
Akr1c6 G A 13: 4,499,053 (GRCm39) V214I probably benign Het
Ano5 G A 7: 51,233,562 (GRCm39) R658H possibly damaging Het
Arhgap11a T A 2: 113,672,255 (GRCm39) I238F possibly damaging Het
Atg2b A T 12: 105,615,383 (GRCm39) Y1024* probably null Het
Cad T A 5: 31,234,191 (GRCm39) D1956E probably damaging Het
Cbs A T 17: 31,843,220 (GRCm39) I237N probably damaging Het
Ccdc81 T C 7: 89,542,337 (GRCm39) T180A probably benign Het
Cftr T A 6: 18,313,686 (GRCm39) N1303K probably benign Het
Col6a4 A G 9: 105,873,315 (GRCm39) S2227P probably benign Het
Crebbp A T 16: 3,972,722 (GRCm39) M324K possibly damaging Het
Dst A G 1: 34,321,574 (GRCm39) K4363R probably damaging Het
Eif2b4 A T 5: 31,348,500 (GRCm39) Y238N probably benign Het
Fam83c G A 2: 155,671,509 (GRCm39) A642V probably benign Het
Fat2 T A 11: 55,175,002 (GRCm39) T1904S probably benign Het
Flt3 T C 5: 147,306,291 (GRCm39) N279S possibly damaging Het
Galnt4 A G 10: 98,945,397 (GRCm39) N374S probably benign Het
Gm14401 T A 2: 176,778,224 (GRCm39) H103Q probably damaging Het
Gm5422 A T 10: 31,126,048 (GRCm39) noncoding transcript Het
Helb G A 10: 119,946,984 (GRCm39) Q110* probably null Het
Ido1 T C 8: 25,081,558 (GRCm39) D41G probably damaging Het
Igfn1 A G 1: 135,898,152 (GRCm39) S805P probably benign Het
Matr3 C A 18: 35,705,147 (GRCm39) A24E probably damaging Het
Mmp23 C T 4: 155,735,710 (GRCm39) C287Y probably damaging Het
Mrnip A G 11: 50,087,918 (GRCm39) R147G probably null Het
Msh6 A G 17: 88,292,147 (GRCm39) K301E possibly damaging Het
Or12d13 A G 17: 37,647,535 (GRCm39) L196P probably damaging Het
Or8g4 G A 9: 39,662,063 (GRCm39) C127Y probably damaging Het
Rora A G 9: 68,561,203 (GRCm39) S11G probably benign Het
Rps6ka5 G T 12: 100,585,839 (GRCm39) H151Q possibly damaging Het
Sgsh A G 11: 119,241,807 (GRCm39) S100P probably damaging Het
Simc1 A G 13: 54,694,902 (GRCm39) T1229A probably benign Het
Slc26a11 T C 11: 119,248,804 (GRCm39) Y62H probably damaging Het
Slc5a8 C T 10: 88,755,290 (GRCm39) L466F possibly damaging Het
Smg1 C T 7: 117,742,570 (GRCm39) V3215I probably benign Het
Smyd2 G A 1: 189,617,579 (GRCm39) P285L possibly damaging Het
Themis2 T C 4: 132,523,567 (GRCm39) probably null Het
Tln1 A G 4: 43,547,732 (GRCm39) V743A probably damaging Het
Tpo T A 12: 30,150,495 (GRCm39) N462Y possibly damaging Het
Wnt2 T A 6: 18,028,145 (GRCm39) M30L probably benign Het
Zfyve9 T C 4: 108,576,365 (GRCm39) I239V probably benign Het
Other mutations in Ptar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Ptar1 APN 19 23,683,165 (GRCm39) missense probably damaging 1.00
IGL02608:Ptar1 APN 19 23,683,076 (GRCm39) missense possibly damaging 0.48
R0134:Ptar1 UTSW 19 23,695,459 (GRCm39) missense probably benign 0.15
R0225:Ptar1 UTSW 19 23,695,459 (GRCm39) missense probably benign 0.15
R0395:Ptar1 UTSW 19 23,697,563 (GRCm39) missense probably damaging 1.00
R0551:Ptar1 UTSW 19 23,697,704 (GRCm39) missense probably benign 0.32
R1414:Ptar1 UTSW 19 23,697,655 (GRCm39) missense possibly damaging 0.89
R3114:Ptar1 UTSW 19 23,695,459 (GRCm39) missense probably benign 0.15
R4016:Ptar1 UTSW 19 23,664,824 (GRCm39) start codon destroyed probably null 0.99
R4431:Ptar1 UTSW 19 23,671,695 (GRCm39) missense probably damaging 1.00
R4897:Ptar1 UTSW 19 23,680,472 (GRCm39) missense probably damaging 1.00
R5054:Ptar1 UTSW 19 23,671,729 (GRCm39) missense probably damaging 1.00
R5928:Ptar1 UTSW 19 23,695,277 (GRCm39) missense probably benign 0.00
R6333:Ptar1 UTSW 19 23,671,686 (GRCm39) missense possibly damaging 0.65
R6610:Ptar1 UTSW 19 23,695,208 (GRCm39) missense probably benign 0.01
R6834:Ptar1 UTSW 19 23,695,288 (GRCm39) missense probably benign
R6915:Ptar1 UTSW 19 23,680,501 (GRCm39) missense probably damaging 1.00
R7381:Ptar1 UTSW 19 23,686,334 (GRCm39) splice site probably null
R7424:Ptar1 UTSW 19 23,695,465 (GRCm39) missense probably damaging 1.00
R7563:Ptar1 UTSW 19 23,697,680 (GRCm39) missense probably benign 0.00
R7884:Ptar1 UTSW 19 23,686,158 (GRCm39) missense probably benign 0.03
R9072:Ptar1 UTSW 19 23,695,414 (GRCm39) missense probably benign
R9331:Ptar1 UTSW 19 23,671,707 (GRCm39) missense probably benign 0.32
R9566:Ptar1 UTSW 19 23,686,206 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAGTGAGTAAATCTGGGG -3'
(R):5'- GAGAGGACAAACACCTGCTC -3'

Sequencing Primer
(F):5'- AGACAGGGTCTCACTGTGTAATCC -3'
(R):5'- TGCTCAGGCAGTGCAGAG -3'
Posted On 2016-11-09