Incidental Mutation 'R5661:Terf1'
ID444062
Institutional Source Beutler Lab
Gene Symbol Terf1
Ensembl Gene ENSMUSG00000025925
Gene Nametelomeric repeat binding factor 1
SynonymsTrbf1, Trf1, Pin2
MMRRC Submission 043304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5661 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location15805646-15844052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15819664 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 221 (V221E)
Ref Sequence ENSEMBL: ENSMUSP00000027057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027057] [ENSMUST00000188371]
Predicted Effect probably damaging
Transcript: ENSMUST00000027057
AA Change: V221E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027057
Gene: ENSMUSG00000025925
AA Change: V221E

DomainStartEndE-ValueType
Pfam:TRF 61 257 2.3e-28 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186565
Predicted Effect possibly damaging
Transcript: ENSMUST00000188371
AA Change: V250E

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140744
Gene: ENSMUSG00000025925
AA Change: V250E

DomainStartEndE-ValueType
Pfam:TRF 61 258 3e-30 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188684
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to repeats in telomeres to form a nucleoprotein complex that protects against the degradation of chromosomal ends. The encoded protein regulates the length of telomeres and is an integral structural component of the functional telomere. This protein is thought to play a role in spindle formation in mitosis. Mutations in this gene are associated with bone marrow failure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality and die sometime before E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 A G 6: 83,520,772 I166T probably damaging Het
Actn1 T C 12: 80,184,844 E273G probably benign Het
Arhgap15 G A 2: 44,322,727 R403H possibly damaging Het
Arhgef26 T C 3: 62,377,654 probably benign Het
Avl9 A T 6: 56,725,102 R81* probably null Het
Brd3 G A 2: 27,461,572 T223I possibly damaging Het
Cacna2d4 T C 6: 119,343,531 M890T probably benign Het
Carm1 A G 9: 21,586,999 D433G probably benign Het
Ccdc40 A G 11: 119,237,927 K427E probably benign Het
Ccdc80 T C 16: 45,127,445 Y929H probably damaging Het
Ccr9 A C 9: 123,780,099 Y282S probably benign Het
Det1 C T 7: 78,843,210 E349K probably damaging Het
Enpep T A 3: 129,276,757 N834Y probably damaging Het
Epha7 A T 4: 28,946,217 probably null Het
Fap A T 2: 62,536,963 probably benign Het
Foxn4 A G 5: 114,272,992 C23R probably benign Het
Gad1-ps T C 10: 99,445,039 noncoding transcript Het
Gli2 C A 1: 118,853,302 E238* probably null Het
Gm20939 C A 17: 94,875,779 H148N probably damaging Het
Gnl1 T C 17: 35,982,555 Y211H probably benign Het
Gpat3 A T 5: 100,885,942 K221* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Hnrnph1 A T 11: 50,384,680 Q415L probably benign Het
Kansl3 T C 1: 36,348,957 E383G possibly damaging Het
Kdm5b T C 1: 134,599,073 V311A probably benign Het
Lipk T A 19: 34,032,327 M215K probably benign Het
Madd A G 2: 91,154,433 probably null Het
Meltf A G 16: 31,881,926 E88G possibly damaging Het
Mis18bp1 A T 12: 65,148,852 S713T probably benign Het
Mocos T A 18: 24,665,995 probably null Het
Msto1 T A 3: 88,912,885 D88V possibly damaging Het
Myo5a A G 9: 75,167,206 Y799C probably benign Het
Nectin4 T A 1: 171,385,170 L357H probably damaging Het
Olfr1184 G A 2: 88,487,097 V122M probably damaging Het
Olfr791 A T 10: 129,526,749 H174L probably benign Het
Pax2 A G 19: 44,790,722 N179S probably damaging Het
Pcdhac2 C A 18: 37,145,446 T493K probably damaging Het
Pgk2 G T 17: 40,207,396 C380* probably null Het
Pi4k2b G A 5: 52,743,564 probably null Het
Plcb3 A G 19: 6,963,220 V416A probably damaging Het
Pom121l2 G A 13: 21,984,255 G899R possibly damaging Het
Ppp4r1 T C 17: 65,803,968 probably null Het
Prkdc G A 16: 15,810,770 E3460K possibly damaging Het
Psmb3 A G 11: 97,706,833 E75G possibly damaging Het
Retnlb C T 16: 48,818,066 T50I probably benign Het
Sec16a A G 2: 26,439,637 S789P probably benign Het
Sec24d C T 3: 123,343,085 T489I probably damaging Het
Sec24d T C 3: 123,343,142 M508T possibly damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Trak1 A G 9: 121,443,637 N187S possibly damaging Het
Trappc11 T A 8: 47,512,607 D528V probably damaging Het
Vmn1r170 A G 7: 23,606,806 N211S possibly damaging Het
Zcchc11 A G 4: 108,513,187 D761G probably benign Het
Zfpm2 G A 15: 41,096,071 W50* probably null Het
Other mutations in Terf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Terf1 APN 1 15833402 missense probably damaging 1.00
R0358:Terf1 UTSW 1 15805838 missense possibly damaging 0.84
R0369:Terf1 UTSW 1 15818983 missense probably damaging 1.00
R1471:Terf1 UTSW 1 15842970 missense probably damaging 1.00
R1853:Terf1 UTSW 1 15818938 nonsense probably null
R1942:Terf1 UTSW 1 15805814 missense probably benign 0.34
R2029:Terf1 UTSW 1 15805946 missense possibly damaging 0.82
R2132:Terf1 UTSW 1 15805685 missense probably benign 0.02
R2391:Terf1 UTSW 1 15805739 nonsense probably null
R4255:Terf1 UTSW 1 15805679 start codon destroyed probably null 1.00
R4685:Terf1 UTSW 1 15818961 missense possibly damaging 0.80
R5291:Terf1 UTSW 1 15819086 splice site probably null
R5310:Terf1 UTSW 1 15805685 missense probably damaging 0.97
R5338:Terf1 UTSW 1 15831563 missense possibly damaging 0.48
R6216:Terf1 UTSW 1 15818997 missense probably benign 0.09
R6719:Terf1 UTSW 1 15838236 missense probably benign 0.01
R7126:Terf1 UTSW 1 15813139 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAAGCAATAGTAATGGCGTTC -3'
(R):5'- CCAGGCTTCCAATTTCAACC -3'

Sequencing Primer
(F):5'- GGCGTTCCAAGTATTGTCAAAATC -3'
(R):5'- ATGGTGGCTCACAACCATCTG -3'
Posted On2016-11-09