Incidental Mutation 'R5661:Kansl3'
ID444063
Institutional Source Beutler Lab
Gene Symbol Kansl3
Ensembl Gene ENSMUSG00000010453
Gene NameKAT8 regulatory NSL complex subunit 3
Synonyms
MMRRC Submission 043304-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5661 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36335730-36369181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36348957 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 383 (E383G)
Ref Sequence ENSEMBL: ENSMUSP00000140547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010597] [ENSMUST00000185912] [ENSMUST00000186470] [ENSMUST00000188961]
Predicted Effect probably benign
Transcript: ENSMUST00000010597
AA Change: E482G

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000010597
Gene: ENSMUSG00000010453
AA Change: E482G

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 718 732 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184898
Predicted Effect possibly damaging
Transcript: ENSMUST00000185912
AA Change: E383G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140547
Gene: ENSMUSG00000010453
AA Change: E383G

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
Pfam:Abhydrolase_5 189 337 9.3e-8 PFAM
low complexity region 424 456 N/A INTRINSIC
low complexity region 570 598 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186470
AA Change: E482G

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140597
Gene: ENSMUSG00000010453
AA Change: E482G

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2.2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 761 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188961
Meta Mutation Damage Score 0.1243 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 A G 6: 83,520,772 I166T probably damaging Het
Actn1 T C 12: 80,184,844 E273G probably benign Het
Arhgap15 G A 2: 44,322,727 R403H possibly damaging Het
Arhgef26 T C 3: 62,377,654 probably benign Het
Avl9 A T 6: 56,725,102 R81* probably null Het
Brd3 G A 2: 27,461,572 T223I possibly damaging Het
Cacna2d4 T C 6: 119,343,531 M890T probably benign Het
Carm1 A G 9: 21,586,999 D433G probably benign Het
Ccdc40 A G 11: 119,237,927 K427E probably benign Het
Ccdc80 T C 16: 45,127,445 Y929H probably damaging Het
Ccr9 A C 9: 123,780,099 Y282S probably benign Het
Det1 C T 7: 78,843,210 E349K probably damaging Het
Enpep T A 3: 129,276,757 N834Y probably damaging Het
Epha7 A T 4: 28,946,217 probably null Het
Fap A T 2: 62,536,963 probably benign Het
Foxn4 A G 5: 114,272,992 C23R probably benign Het
Gad1-ps T C 10: 99,445,039 noncoding transcript Het
Gli2 C A 1: 118,853,302 E238* probably null Het
Gm20939 C A 17: 94,875,779 H148N probably damaging Het
Gnl1 T C 17: 35,982,555 Y211H probably benign Het
Gpat3 A T 5: 100,885,942 K221* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Hnrnph1 A T 11: 50,384,680 Q415L probably benign Het
Kdm5b T C 1: 134,599,073 V311A probably benign Het
Lipk T A 19: 34,032,327 M215K probably benign Het
Madd A G 2: 91,154,433 probably null Het
Meltf A G 16: 31,881,926 E88G possibly damaging Het
Mis18bp1 A T 12: 65,148,852 S713T probably benign Het
Mocos T A 18: 24,665,995 probably null Het
Msto1 T A 3: 88,912,885 D88V possibly damaging Het
Myo5a A G 9: 75,167,206 Y799C probably benign Het
Nectin4 T A 1: 171,385,170 L357H probably damaging Het
Olfr1184 G A 2: 88,487,097 V122M probably damaging Het
Olfr791 A T 10: 129,526,749 H174L probably benign Het
Pax2 A G 19: 44,790,722 N179S probably damaging Het
Pcdhac2 C A 18: 37,145,446 T493K probably damaging Het
Pgk2 G T 17: 40,207,396 C380* probably null Het
Pi4k2b G A 5: 52,743,564 probably null Het
Plcb3 A G 19: 6,963,220 V416A probably damaging Het
Pom121l2 G A 13: 21,984,255 G899R possibly damaging Het
Ppp4r1 T C 17: 65,803,968 probably null Het
Prkdc G A 16: 15,810,770 E3460K possibly damaging Het
Psmb3 A G 11: 97,706,833 E75G possibly damaging Het
Retnlb C T 16: 48,818,066 T50I probably benign Het
Sec16a A G 2: 26,439,637 S789P probably benign Het
Sec24d C T 3: 123,343,085 T489I probably damaging Het
Sec24d T C 3: 123,343,142 M508T possibly damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Terf1 T A 1: 15,819,664 V221E probably damaging Het
Trak1 A G 9: 121,443,637 N187S possibly damaging Het
Trappc11 T A 8: 47,512,607 D528V probably damaging Het
Vmn1r170 A G 7: 23,606,806 N211S possibly damaging Het
Zcchc11 A G 4: 108,513,187 D761G probably benign Het
Zfpm2 G A 15: 41,096,071 W50* probably null Het
Other mutations in Kansl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Kansl3 APN 1 36367989 start gained probably benign
IGL02277:Kansl3 APN 1 36348947 missense possibly damaging 0.85
IGL02423:Kansl3 APN 1 36351969 missense probably damaging 1.00
R0147:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0148:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0255:Kansl3 UTSW 1 36344969 missense probably benign 0.01
R0279:Kansl3 UTSW 1 36351969 missense probably damaging 0.99
R0349:Kansl3 UTSW 1 36351783 missense probably damaging 1.00
R1452:Kansl3 UTSW 1 36354793 splice site probably benign
R1599:Kansl3 UTSW 1 36367870 missense probably damaging 1.00
R1842:Kansl3 UTSW 1 36351744 missense probably damaging 1.00
R2310:Kansl3 UTSW 1 36343364 missense probably damaging 1.00
R4093:Kansl3 UTSW 1 36344954 missense probably damaging 1.00
R4961:Kansl3 UTSW 1 36348683 critical splice acceptor site probably null
R5339:Kansl3 UTSW 1 36367721 intron probably benign
R5400:Kansl3 UTSW 1 36358149 missense possibly damaging 0.93
R5564:Kansl3 UTSW 1 36345964 missense possibly damaging 0.55
R5965:Kansl3 UTSW 1 36345520 intron probably null
R6185:Kansl3 UTSW 1 36346018 missense probably damaging 0.96
R6261:Kansl3 UTSW 1 36365605 missense probably benign 0.01
R6706:Kansl3 UTSW 1 36344914 critical splice donor site probably null
R7055:Kansl3 UTSW 1 36365620 missense possibly damaging 0.86
R7134:Kansl3 UTSW 1 36351767 missense possibly damaging 0.52
R7362:Kansl3 UTSW 1 36344127 missense possibly damaging 0.82
R7461:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7571:Kansl3 UTSW 1 36365587 missense possibly damaging 0.55
R7613:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7775:Kansl3 UTSW 1 36348677 missense probably damaging 0.99
R7778:Kansl3 UTSW 1 36348677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATTCCCAGACATTCCCAC -3'
(R):5'- AGCTAAGCTTGGCCTGTATGTG -3'

Sequencing Primer
(F):5'- GATTCCCAGACATTCCCACAAAGG -3'
(R):5'- ATGTGGCCTTGGGAGTGGAAAG -3'
Posted On2016-11-09