Mutagenetix > Incidental Mutation

Incidental Mutation 'R5661:Sec24d'

444075

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

043304-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5661 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123343085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 489 (T489I)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably damaging
Transcript: ENSMUST00000047923
AA Change: T489I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: T489I

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Meta Mutation Damage Score

0.9430

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actg2	A	G	6: 83,520,772	I166T	probably damaging	Het
Actn1	T	C	12: 80,184,844	E273G	probably benign	Het
Arhgap15	G	A	2: 44,322,727	R403H	possibly damaging	Het
Arhgef26	T	C	3: 62,377,654		probably benign	Het
Avl9	A	T	6: 56,725,102	R81*	probably null	Het
Brd3	G	A	2: 27,461,572	T223I	possibly damaging	Het
Cacna2d4	T	C	6: 119,343,531	M890T	probably benign	Het
Carm1	A	G	9: 21,586,999	D433G	probably benign	Het
Ccdc40	A	G	11: 119,237,927	K427E	probably benign	Het
Ccdc80	T	C	16: 45,127,445	Y929H	probably damaging	Het
Ccr9	A	C	9: 123,780,099	Y282S	probably benign	Het
Det1	C	T	7: 78,843,210	E349K	probably damaging	Het
Enpep	T	A	3: 129,276,757	N834Y	probably damaging	Het
Epha7	A	T	4: 28,946,217		probably null	Het
Fap	A	T	2: 62,536,963		probably benign	Het
Foxn4	A	G	5: 114,272,992	C23R	probably benign	Het
Gad1-ps	T	C	10: 99,445,039		noncoding transcript	Het
Gli2	C	A	1: 118,853,302	E238*	probably null	Het
Gm20939	C	A	17: 94,875,779	H148N	probably damaging	Het
Gnl1	T	C	17: 35,982,555	Y211H	probably benign	Het
Gpat3	A	T	5: 100,885,942	K221*	probably null	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hnrnph1	A	T	11: 50,384,680	Q415L	probably benign	Het
Kansl3	T	C	1: 36,348,957	E383G	possibly damaging	Het
Kdm5b	T	C	1: 134,599,073	V311A	probably benign	Het
Lipk	T	A	19: 34,032,327	M215K	probably benign	Het
Madd	A	G	2: 91,154,433		probably null	Het
Meltf	A	G	16: 31,881,926	E88G	possibly damaging	Het
Mis18bp1	A	T	12: 65,148,852	S713T	probably benign	Het
Mocos	T	A	18: 24,665,995		probably null	Het
Msto1	T	A	3: 88,912,885	D88V	possibly damaging	Het
Myo5a	A	G	9: 75,167,206	Y799C	probably benign	Het
Nectin4	T	A	1: 171,385,170	L357H	probably damaging	Het
Olfr1184	G	A	2: 88,487,097	V122M	probably damaging	Het
Olfr791	A	T	10: 129,526,749	H174L	probably benign	Het
Pax2	A	G	19: 44,790,722	N179S	probably damaging	Het
Pcdhac2	C	A	18: 37,145,446	T493K	probably damaging	Het
Pgk2	G	T	17: 40,207,396	C380*	probably null	Het
Pi4k2b	G	A	5: 52,743,564		probably null	Het
Plcb3	A	G	19: 6,963,220	V416A	probably damaging	Het
Pom121l2	G	A	13: 21,984,255	G899R	possibly damaging	Het
Ppp4r1	T	C	17: 65,803,968		probably null	Het
Prkdc	G	A	16: 15,810,770	E3460K	possibly damaging	Het
Psmb3	A	G	11: 97,706,833	E75G	possibly damaging	Het
Retnlb	C	T	16: 48,818,066	T50I	probably benign	Het
Sec16a	A	G	2: 26,439,637	S789P	probably benign	Het
Slc5a8	C	T	10: 88,919,428	L466F	possibly damaging	Het
Terf1	T	A	1: 15,819,664	V221E	probably damaging	Het
Trak1	A	G	9: 121,443,637	N187S	possibly damaging	Het
Trappc11	T	A	8: 47,512,607	D528V	probably damaging	Het
Vmn1r170	A	G	7: 23,606,806	N211S	possibly damaging	Het
Zcchc11	A	G	4: 108,513,187	D761G	probably benign	Het
Zfpm2	G	A	15: 41,096,071	W50*	probably null	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign
R9447:Sec24d	UTSW	3	123290513	missense	probably benign	0.00
R9701:Sec24d	UTSW	3	123269672	missense	probably damaging	1.00
R9758:Sec24d	UTSW	3	123343154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGCCTCATCTCGCTGGTAG -3'
(R):5'- TTCAAACACACATCTGATCTGCATC -3'

Sequencing Primer
(F):5'- GCCTCATCTCGCTGGTAGAAAAATG -3'
(R):5'- TCTGATCTGCATCACACTGAAAG -3'

Posted On

2016-11-09