Incidental Mutation 'R5661:Det1'
ID444086
Institutional Source Beutler Lab
Gene Symbol Det1
Ensembl Gene ENSMUSG00000030610
Gene Namede-etiolated homolog 1 (Arabidopsis)
Synonyms2610034H20Rik
MMRRC Submission 043304-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R5661 (G1)
Quality Score183
Status Validated
Chromosome7
Chromosomal Location78821547-78847263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78843210 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 349 (E349K)
Ref Sequence ENSEMBL: ENSMUSP00000032839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032839] [ENSMUST00000107431]
Predicted Effect probably damaging
Transcript: ENSMUST00000032839
AA Change: E349K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032839
Gene: ENSMUSG00000030610
AA Change: E349K

DomainStartEndE-ValueType
Pfam:Det1 142 547 2.6e-198 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107431
SMART Domains Protein: ENSMUSP00000103054
Gene: ENSMUSG00000030610

DomainStartEndE-ValueType
Pfam:Det1 6 138 2.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205762
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 A G 6: 83,520,772 I166T probably damaging Het
Actn1 T C 12: 80,184,844 E273G probably benign Het
Arhgap15 G A 2: 44,322,727 R403H possibly damaging Het
Arhgef26 T C 3: 62,377,654 probably benign Het
Avl9 A T 6: 56,725,102 R81* probably null Het
Brd3 G A 2: 27,461,572 T223I possibly damaging Het
Cacna2d4 T C 6: 119,343,531 M890T probably benign Het
Carm1 A G 9: 21,586,999 D433G probably benign Het
Ccdc40 A G 11: 119,237,927 K427E probably benign Het
Ccdc80 T C 16: 45,127,445 Y929H probably damaging Het
Ccr9 A C 9: 123,780,099 Y282S probably benign Het
Enpep T A 3: 129,276,757 N834Y probably damaging Het
Epha7 A T 4: 28,946,217 probably null Het
Fap A T 2: 62,536,963 probably benign Het
Foxn4 A G 5: 114,272,992 C23R probably benign Het
Gad1-ps T C 10: 99,445,039 noncoding transcript Het
Gli2 C A 1: 118,853,302 E238* probably null Het
Gm20939 C A 17: 94,875,779 H148N probably damaging Het
Gnl1 T C 17: 35,982,555 Y211H probably benign Het
Gpat3 A T 5: 100,885,942 K221* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Hnrnph1 A T 11: 50,384,680 Q415L probably benign Het
Kansl3 T C 1: 36,348,957 E383G possibly damaging Het
Kdm5b T C 1: 134,599,073 V311A probably benign Het
Lipk T A 19: 34,032,327 M215K probably benign Het
Madd A G 2: 91,154,433 probably null Het
Meltf A G 16: 31,881,926 E88G possibly damaging Het
Mis18bp1 A T 12: 65,148,852 S713T probably benign Het
Mocos T A 18: 24,665,995 probably null Het
Msto1 T A 3: 88,912,885 D88V possibly damaging Het
Myo5a A G 9: 75,167,206 Y799C probably benign Het
Nectin4 T A 1: 171,385,170 L357H probably damaging Het
Olfr1184 G A 2: 88,487,097 V122M probably damaging Het
Olfr791 A T 10: 129,526,749 H174L probably benign Het
Pax2 A G 19: 44,790,722 N179S probably damaging Het
Pcdhac2 C A 18: 37,145,446 T493K probably damaging Het
Pgk2 G T 17: 40,207,396 C380* probably null Het
Pi4k2b G A 5: 52,743,564 probably null Het
Plcb3 A G 19: 6,963,220 V416A probably damaging Het
Pom121l2 G A 13: 21,984,255 G899R possibly damaging Het
Ppp4r1 T C 17: 65,803,968 probably null Het
Prkdc G A 16: 15,810,770 E3460K possibly damaging Het
Psmb3 A G 11: 97,706,833 E75G possibly damaging Het
Retnlb C T 16: 48,818,066 T50I probably benign Het
Sec16a A G 2: 26,439,637 S789P probably benign Het
Sec24d C T 3: 123,343,085 T489I probably damaging Het
Sec24d T C 3: 123,343,142 M508T possibly damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Terf1 T A 1: 15,819,664 V221E probably damaging Het
Trak1 A G 9: 121,443,637 N187S possibly damaging Het
Trappc11 T A 8: 47,512,607 D528V probably damaging Het
Vmn1r170 A G 7: 23,606,806 N211S possibly damaging Het
Zcchc11 A G 4: 108,513,187 D761G probably benign Het
Zfpm2 G A 15: 41,096,071 W50* probably null Het
Other mutations in Det1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Det1 APN 7 78840059 missense probably benign 0.00
IGL01611:Det1 APN 7 78827954 missense possibly damaging 0.92
IGL01924:Det1 APN 7 78843823 nonsense probably null
IGL02194:Det1 APN 7 78840164 missense probably benign 0.00
IGL03387:Det1 APN 7 78843624 missense possibly damaging 0.77
R0418:Det1 UTSW 7 78844017 missense probably benign 0.08
R0633:Det1 UTSW 7 78843935 missense probably benign 0.11
R1959:Det1 UTSW 7 78843443 missense probably benign 0.08
R1966:Det1 UTSW 7 78843218 missense probably damaging 1.00
R4612:Det1 UTSW 7 78843706 missense probably damaging 1.00
R4809:Det1 UTSW 7 78843807 missense probably damaging 1.00
R5193:Det1 UTSW 7 78843554 missense probably damaging 1.00
R7106:Det1 UTSW 7 78843464 missense probably damaging 1.00
R7673:Det1 UTSW 7 78843611 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGGTGAGACTACATCTGTGTGG -3'
(R):5'- TCAGGGACCCTTTCATCAAC -3'

Sequencing Primer
(F):5'- ATCTGAGCTCCTACGTGACAG -3'
(R):5'- GGACCCTTTCATCAACTCCTTGAAG -3'
Posted On2016-11-09