Incidental Mutation 'R5661:Trappc11'
ID444087
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
MMRRC Submission 043304-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5661 (G1)
Quality Score181
Status Validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47512607 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 528 (D528V)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]
Predicted Effect probably damaging
Transcript: ENSMUST00000039061
AA Change: D528V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: D528V

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120987
SMART Domains Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

DomainStartEndE-ValueType
Pfam:Gryzun 1 155 4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125065
Meta Mutation Damage Score 0.1379 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 A G 6: 83,520,772 I166T probably damaging Het
Actn1 T C 12: 80,184,844 E273G probably benign Het
Arhgap15 G A 2: 44,322,727 R403H possibly damaging Het
Arhgef26 T C 3: 62,377,654 probably benign Het
Avl9 A T 6: 56,725,102 R81* probably null Het
Brd3 G A 2: 27,461,572 T223I possibly damaging Het
Cacna2d4 T C 6: 119,343,531 M890T probably benign Het
Carm1 A G 9: 21,586,999 D433G probably benign Het
Ccdc40 A G 11: 119,237,927 K427E probably benign Het
Ccdc80 T C 16: 45,127,445 Y929H probably damaging Het
Ccr9 A C 9: 123,780,099 Y282S probably benign Het
Det1 C T 7: 78,843,210 E349K probably damaging Het
Enpep T A 3: 129,276,757 N834Y probably damaging Het
Epha7 A T 4: 28,946,217 probably null Het
Fap A T 2: 62,536,963 probably benign Het
Foxn4 A G 5: 114,272,992 C23R probably benign Het
Gad1-ps T C 10: 99,445,039 noncoding transcript Het
Gli2 C A 1: 118,853,302 E238* probably null Het
Gm20939 C A 17: 94,875,779 H148N probably damaging Het
Gnl1 T C 17: 35,982,555 Y211H probably benign Het
Gpat3 A T 5: 100,885,942 K221* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Hnrnph1 A T 11: 50,384,680 Q415L probably benign Het
Kansl3 T C 1: 36,348,957 E383G possibly damaging Het
Kdm5b T C 1: 134,599,073 V311A probably benign Het
Lipk T A 19: 34,032,327 M215K probably benign Het
Madd A G 2: 91,154,433 probably null Het
Meltf A G 16: 31,881,926 E88G possibly damaging Het
Mis18bp1 A T 12: 65,148,852 S713T probably benign Het
Mocos T A 18: 24,665,995 probably null Het
Msto1 T A 3: 88,912,885 D88V possibly damaging Het
Myo5a A G 9: 75,167,206 Y799C probably benign Het
Nectin4 T A 1: 171,385,170 L357H probably damaging Het
Olfr1184 G A 2: 88,487,097 V122M probably damaging Het
Olfr791 A T 10: 129,526,749 H174L probably benign Het
Pax2 A G 19: 44,790,722 N179S probably damaging Het
Pcdhac2 C A 18: 37,145,446 T493K probably damaging Het
Pgk2 G T 17: 40,207,396 C380* probably null Het
Pi4k2b G A 5: 52,743,564 probably null Het
Plcb3 A G 19: 6,963,220 V416A probably damaging Het
Pom121l2 G A 13: 21,984,255 G899R possibly damaging Het
Ppp4r1 T C 17: 65,803,968 probably null Het
Prkdc G A 16: 15,810,770 E3460K possibly damaging Het
Psmb3 A G 11: 97,706,833 E75G possibly damaging Het
Retnlb C T 16: 48,818,066 T50I probably benign Het
Sec16a A G 2: 26,439,637 S789P probably benign Het
Sec24d C T 3: 123,343,085 T489I probably damaging Het
Sec24d T C 3: 123,343,142 M508T possibly damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Terf1 T A 1: 15,819,664 V221E probably damaging Het
Trak1 A G 9: 121,443,637 N187S possibly damaging Het
Vmn1r170 A G 7: 23,606,806 N211S possibly damaging Het
Zcchc11 A G 4: 108,513,187 D761G probably benign Het
Zfpm2 G A 15: 41,096,071 W50* probably null Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 splice site probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 splice site probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 splice site probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R7964:Trappc11 UTSW 8 47526944 missense possibly damaging 0.54
R8183:Trappc11 UTSW 8 47529356 missense possibly damaging 0.93
R8282:Trappc11 UTSW 8 47516589 missense probably damaging 0.97
R8733:Trappc11 UTSW 8 47501848 missense probably damaging 1.00
R8782:Trappc11 UTSW 8 47498666 missense probably benign 0.44
R8853:Trappc11 UTSW 8 47529404 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTCAGGTTCAGGGTCAG -3'
(R):5'- CGGTCATGTTAGAAGCACTTGC -3'

Sequencing Primer
(F):5'- CAGGGCTTTCATTCTGCAATG -3'
(R):5'- GCTAGTCAGCCTGTCATAACTGG -3'
Posted On2016-11-09