Incidental Mutation 'R5661:Mocos'
ID444110
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Namemolybdenum cofactor sulfurase
Synonyms1110018O12Rik
MMRRC Submission 043304-MU
Accession Numbers

NCBI RefSeq: NM_026779.1; MGI:1915841

Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R5661 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24653691-24701556 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 24665995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
Predicted Effect probably null
Transcript: ENSMUST00000068006
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 A G 6: 83,520,772 I166T probably damaging Het
Actn1 T C 12: 80,184,844 E273G probably benign Het
Arhgap15 G A 2: 44,322,727 R403H possibly damaging Het
Arhgef26 T C 3: 62,377,654 probably benign Het
Avl9 A T 6: 56,725,102 R81* probably null Het
Brd3 G A 2: 27,461,572 T223I possibly damaging Het
Cacna2d4 T C 6: 119,343,531 M890T probably benign Het
Carm1 A G 9: 21,586,999 D433G probably benign Het
Ccdc40 A G 11: 119,237,927 K427E probably benign Het
Ccdc80 T C 16: 45,127,445 Y929H probably damaging Het
Ccr9 A C 9: 123,780,099 Y282S probably benign Het
Det1 C T 7: 78,843,210 E349K probably damaging Het
Enpep T A 3: 129,276,757 N834Y probably damaging Het
Epha7 A T 4: 28,946,217 probably null Het
Fap A T 2: 62,536,963 probably benign Het
Foxn4 A G 5: 114,272,992 C23R probably benign Het
Gad1-ps T C 10: 99,445,039 noncoding transcript Het
Gli2 C A 1: 118,853,302 E238* probably null Het
Gm20939 C A 17: 94,875,779 H148N probably damaging Het
Gnl1 T C 17: 35,982,555 Y211H probably benign Het
Gpat3 A T 5: 100,885,942 K221* probably null Het
Hjurp G C 1: 88,277,215 probably benign Het
Hnrnph1 A T 11: 50,384,680 Q415L probably benign Het
Kansl3 T C 1: 36,348,957 E383G possibly damaging Het
Kdm5b T C 1: 134,599,073 V311A probably benign Het
Lipk T A 19: 34,032,327 M215K probably benign Het
Madd A G 2: 91,154,433 probably null Het
Meltf A G 16: 31,881,926 E88G possibly damaging Het
Mis18bp1 A T 12: 65,148,852 S713T probably benign Het
Msto1 T A 3: 88,912,885 D88V possibly damaging Het
Myo5a A G 9: 75,167,206 Y799C probably benign Het
Nectin4 T A 1: 171,385,170 L357H probably damaging Het
Olfr1184 G A 2: 88,487,097 V122M probably damaging Het
Olfr791 A T 10: 129,526,749 H174L probably benign Het
Pax2 A G 19: 44,790,722 N179S probably damaging Het
Pcdhac2 C A 18: 37,145,446 T493K probably damaging Het
Pgk2 G T 17: 40,207,396 C380* probably null Het
Pi4k2b G A 5: 52,743,564 probably null Het
Plcb3 A G 19: 6,963,220 V416A probably damaging Het
Pom121l2 G A 13: 21,984,255 G899R possibly damaging Het
Ppp4r1 T C 17: 65,803,968 probably null Het
Prkdc G A 16: 15,810,770 E3460K possibly damaging Het
Psmb3 A G 11: 97,706,833 E75G possibly damaging Het
Retnlb C T 16: 48,818,066 T50I probably benign Het
Sec16a A G 2: 26,439,637 S789P probably benign Het
Sec24d T C 3: 123,343,142 M508T possibly damaging Het
Sec24d C T 3: 123,343,085 T489I probably damaging Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Terf1 T A 1: 15,819,664 V221E probably damaging Het
Trak1 A G 9: 121,443,637 N187S possibly damaging Het
Trappc11 T A 8: 47,512,607 D528V probably damaging Het
Vmn1r170 A G 7: 23,606,806 N211S possibly damaging Het
Zcchc11 A G 4: 108,513,187 D761G probably benign Het
Zfpm2 G A 15: 41,096,071 W50* probably null Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24660044 missense possibly damaging 0.88
IGL01859:Mocos APN 18 24666660 splice site probably benign
IGL01884:Mocos APN 18 24683216 missense probably damaging 1.00
IGL02174:Mocos APN 18 24695896 missense probably benign 0.00
IGL02966:Mocos APN 18 24676611 missense probably damaging 1.00
IGL02976:Mocos APN 18 24666569 missense possibly damaging 0.92
P0008:Mocos UTSW 18 24679606 missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24686702 missense probably damaging 1.00
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0132:Mocos UTSW 18 24679762 missense probably benign 0.01
R0265:Mocos UTSW 18 24666276 missense probably benign 0.01
R0737:Mocos UTSW 18 24688987 missense probably damaging 0.98
R1231:Mocos UTSW 18 24679701 missense probably benign 0.01
R1351:Mocos UTSW 18 24660050 missense probably damaging 1.00
R1699:Mocos UTSW 18 24683216 missense probably damaging 1.00
R1853:Mocos UTSW 18 24695969 missense probably damaging 1.00
R2190:Mocos UTSW 18 24664057 missense probably benign 0.01
R2350:Mocos UTSW 18 24666656 splice site probably benign
R2680:Mocos UTSW 18 24676629 missense probably damaging 1.00
R3840:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3841:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3847:Mocos UTSW 18 24676662 missense probably damaging 0.99
R4059:Mocos UTSW 18 24679390 missense probably damaging 1.00
R4158:Mocos UTSW 18 24674246 missense probably damaging 0.99
R4205:Mocos UTSW 18 24666191 missense possibly damaging 0.88
R4514:Mocos UTSW 18 24683212 missense probably damaging 0.99
R4589:Mocos UTSW 18 24654038 missense probably damaging 0.99
R4667:Mocos UTSW 18 24666434 missense probably benign 0.11
R4668:Mocos UTSW 18 24666434 missense probably benign 0.11
R5162:Mocos UTSW 18 24654052 missense probably damaging 0.98
R5187:Mocos UTSW 18 24692554 missense probably damaging 0.97
R5533:Mocos UTSW 18 24674300 missense probably damaging 1.00
R5629:Mocos UTSW 18 24664085 critical splice donor site probably null
R5952:Mocos UTSW 18 24701387 missense possibly damaging 0.91
R5987:Mocos UTSW 18 24686693 missense probably damaging 1.00
R6173:Mocos UTSW 18 24676582 missense probably benign 0.03
R6209:Mocos UTSW 18 24666615 missense probably benign 0.41
R6376:Mocos UTSW 18 24701485 missense possibly damaging 0.50
R6416:Mocos UTSW 18 24701456 missense probably damaging 0.99
R6452:Mocos UTSW 18 24695941 missense probably benign 0.02
R6520:Mocos UTSW 18 24666390 missense probably benign 0.01
R6631:Mocos UTSW 18 24699931 missense probably benign 0.03
R6669:Mocos UTSW 18 24666410 missense probably damaging 0.98
R7114:Mocos UTSW 18 24666515 missense probably damaging 1.00
R7366:Mocos UTSW 18 24676616 missense probably damaging 1.00
R7690:Mocos UTSW 18 24664025 missense probably damaging 1.00
Z1176:Mocos UTSW 18 24670633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGTCCAAGCAGAGATGGG -3'
(R):5'- ATGTGACACTCATGGCTGCAG -3'

Sequencing Primer
(F):5'- GCTCCAGAGGCAAGAAGTTTAAATTC -3'
(R):5'- TTCCTCATTCCCACCACAGAGG -3'
Posted On2016-11-09