Incidental Mutation 'R5662:Eprs'
ID444115
Institutional Source Beutler Lab
Gene Symbol Eprs
Ensembl Gene ENSMUSG00000026615
Gene Nameglutamyl-prolyl-tRNA synthetase
Synonyms2410081F06Rik, 3010002K18Rik, Qprs
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location185363044-185428360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 185394425 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 519 (N519K)
Ref Sequence ENSEMBL: ENSMUSP00000045841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046514
AA Change: N519K

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: N519K

DomainStartEndE-ValueType
Pfam:GST_C_3 71 156 2.1e-15 PFAM
Pfam:GST_C 72 157 2.9e-7 PFAM
Pfam:tRNA-synt_1c 197 502 8.8e-127 PFAM
Pfam:tRNA-synt_1c_C 504 681 4.4e-42 PFAM
WHEP-TRS 753 815 1.26e-25 SMART
WHEP-TRS 826 888 1.47e-26 SMART
WHEP-TRS 904 966 3.76e-24 SMART
low complexity region 984 1011 N/A INTRINSIC
Pfam:tRNA-synt_2b 1107 1287 3.1e-17 PFAM
Pfam:HGTP_anticodon 1303 1404 1.7e-19 PFAM
ProRS-C_1 1430 1512 5.27e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192284
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Eprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Eprs APN 1 185407148 missense probably benign 0.11
IGL00532:Eprs APN 1 185407148 missense probably benign 0.11
IGL00543:Eprs APN 1 185407148 missense probably benign 0.11
IGL00553:Eprs APN 1 185407148 missense probably benign 0.11
IGL00574:Eprs APN 1 185407148 missense probably benign 0.11
IGL00583:Eprs APN 1 185407148 missense probably benign 0.11
IGL00946:Eprs APN 1 185407701 missense probably benign 0.02
IGL01062:Eprs APN 1 185379615 missense probably benign 0.19
IGL01477:Eprs APN 1 185411375 splice site probably benign
IGL01608:Eprs APN 1 185385114 unclassified probably benign
IGL01767:Eprs APN 1 185384915 missense probably damaging 0.98
IGL02136:Eprs APN 1 185384983 missense probably damaging 1.00
IGL02302:Eprs APN 1 185387124 splice site probably benign
IGL02528:Eprs APN 1 185413489 missense probably damaging 1.00
IGL02631:Eprs APN 1 185427898 missense probably damaging 1.00
IGL02989:Eprs APN 1 185418366 missense probably benign 0.31
IGL03004:Eprs APN 1 185381833 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0179:Eprs UTSW 1 185413547 missense probably benign
R0783:Eprs UTSW 1 185398458 missense probably damaging 1.00
R1319:Eprs UTSW 1 185384962 missense probably damaging 1.00
R1335:Eprs UTSW 1 185387089 missense probably damaging 1.00
R1514:Eprs UTSW 1 185381834 missense probably damaging 0.99
R1590:Eprs UTSW 1 185401510 missense probably damaging 1.00
R1688:Eprs UTSW 1 185384896 missense probably damaging 0.99
R1725:Eprs UTSW 1 185406992 missense probably damaging 1.00
R2182:Eprs UTSW 1 185379742 splice site probably null
R2228:Eprs UTSW 1 185367537 missense probably damaging 1.00
R2336:Eprs UTSW 1 185411374 splice site probably benign
R2338:Eprs UTSW 1 185415808 missense probably damaging 1.00
R2439:Eprs UTSW 1 185379742 splice site probably null
R2914:Eprs UTSW 1 185379742 splice site probably null
R3001:Eprs UTSW 1 185424391 critical splice donor site probably null
R3002:Eprs UTSW 1 185424391 critical splice donor site probably null
R3003:Eprs UTSW 1 185424391 critical splice donor site probably null
R3547:Eprs UTSW 1 185379742 splice site probably null
R3775:Eprs UTSW 1 185373008 missense probably damaging 1.00
R3878:Eprs UTSW 1 185415953 critical splice donor site probably null
R3902:Eprs UTSW 1 185379742 splice site probably null
R3913:Eprs UTSW 1 185379742 splice site probably null
R4579:Eprs UTSW 1 185401607 missense probably damaging 1.00
R4664:Eprs UTSW 1 185373076 intron probably benign
R4680:Eprs UTSW 1 185386278 missense possibly damaging 0.87
R4712:Eprs UTSW 1 185428108 missense probably benign 0.00
R4749:Eprs UTSW 1 185396130 missense probably damaging 0.97
R4995:Eprs UTSW 1 185410139 intron probably benign
R5154:Eprs UTSW 1 185413465 missense probably damaging 1.00
R5640:Eprs UTSW 1 185374184 missense probably benign 0.34
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6151:Eprs UTSW 1 185407754 critical splice donor site probably null
R6387:Eprs UTSW 1 185387084 missense possibly damaging 0.94
R6647:Eprs UTSW 1 185414424 missense probably damaging 1.00
R6701:Eprs UTSW 1 185370890 missense probably damaging 0.99
R6997:Eprs UTSW 1 185396163 missense possibly damaging 0.50
R7295:Eprs UTSW 1 185418210 critical splice acceptor site probably null
R7305:Eprs UTSW 1 185379701 missense probably damaging 1.00
R7729:Eprs UTSW 1 185413169 missense probably damaging 1.00
R7732:Eprs UTSW 1 185372939 missense probably benign 0.01
R7733:Eprs UTSW 1 185397161 missense probably benign
R7826:Eprs UTSW 1 185406968 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCGATGAAACACGAGTAAATGC -3'
(R):5'- TCCTAAGGAATCATACACTGTAACTGT -3'

Sequencing Primer
(F):5'- TGCAGTAACAAAGAAAGCCACTTAG -3'
(R):5'- CAGAAGGTGCCATCTAAGCTTTCAG -3'
Posted On2016-11-09