Incidental Mutation 'R5662:Cers2'
ID444121
Institutional Source Beutler Lab
Gene Symbol Cers2
Ensembl Gene ENSMUSG00000015714
Gene Nameceramide synthase 2
SynonymsTrh3, 0610013I17Rik, Lass2, CerS2
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95314791-95323599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95320984 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 112 (R112C)
Ref Sequence ENSEMBL: ENSMUSP00000120190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171] [ENSMUST00000129267] [ENSMUST00000139498] [ENSMUST00000139866]
Predicted Effect probably benign
Transcript: ENSMUST00000015841
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000015858
AA Change: R112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714
AA Change: R112C

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107170
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107171
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124638
Predicted Effect probably damaging
Transcript: ENSMUST00000129267
AA Change: R112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121110
Gene: ENSMUSG00000015714
AA Change: R112C

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
transmembrane domain 136 155 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134702
Predicted Effect probably damaging
Transcript: ENSMUST00000139498
AA Change: R112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122672
Gene: ENSMUSG00000015714
AA Change: R112C

DomainStartEndE-ValueType
Pfam:Homeobox 65 127 5.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139866
AA Change: R112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120190
Gene: ENSMUSG00000015714
AA Change: R112C

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 246 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156850
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to yeast longevity assurance gene 1. Mutation or overexpression of the related gene in yeast has been shown to alter yeast lifespan. The human protein may play a role in the regulation of cell growth. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal ceramide species and myelin sheath defects and develop hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Cers2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Cers2 APN 3 95321900 missense probably damaging 1.00
IGL00328:Cers2 APN 3 95320686 missense probably benign 0.37
IGL01561:Cers2 APN 3 95322161 splice site probably null
IGL02993:Cers2 APN 3 95320085 missense probably benign 0.00
IGL03115:Cers2 APN 3 95321352 missense probably damaging 1.00
IGL03232:Cers2 APN 3 95320157 missense probably damaging 0.97
R0118:Cers2 UTSW 3 95320226 missense probably benign 0.00
R2849:Cers2 UTSW 3 95322459 missense probably benign 0.42
R4709:Cers2 UTSW 3 95320223 missense possibly damaging 0.82
R5320:Cers2 UTSW 3 95320994 missense probably null 0.99
R5821:Cers2 UTSW 3 95321697 intron probably benign
R6808:Cers2 UTSW 3 95321009 missense probably benign 0.27
R7049:Cers2 UTSW 3 95321654 missense probably damaging 1.00
R7117:Cers2 UTSW 3 95320761 critical splice donor site probably null
R7388:Cers2 UTSW 3 95321345 missense probably benign 0.14
R8059:Cers2 UTSW 3 95322671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGATTCTGGCAGTTGCTG -3'
(R):5'- GGGAGGATCAACAGTTTCCC -3'

Sequencing Primer
(F):5'- GGTCAGAGTTTGAATGCTTGC -3'
(R):5'- AGTTTCCCACTGCCCCCAG -3'
Posted On2016-11-09