Mutagenetix > Incidental Mutation

Incidental Mutation 'R5662:Ephb4'

444126

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

043305-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5662 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 137372195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 886 (I886F)

Ref Sequence

ENSEMBL: ENSMUSP00000106683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

probably damaging
Transcript: ENSMUST00000061244
AA Change: I886F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: I886F

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111054
AA Change: I886F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: I886F

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111055
AA Change: I895F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: I895F

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144296
AA Change: I886F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: I886F

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166239
AA Change: I886F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: I886F

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	A	7: 79,100,107	V1542D	possibly damaging	Het
Acsm4	T	G	7: 119,694,800	N131K	possibly damaging	Het
Ankrd54	A	G	15: 79,062,614	S62P	possibly damaging	Het
Ccdc186	A	G	19: 56,793,488	I753T	probably benign	Het
Cers2	C	T	3: 95,320,984	R112C	probably damaging	Het
Col6a4	C	G	9: 106,068,001	R971S	probably damaging	Het
Ctsf	T	C	19: 4,856,578	S178P	probably damaging	Het
D430042O09Rik	A	G	7: 125,842,703	R595G	probably benign	Het
Dennd4c	C	T	4: 86,795,288	T492I	probably benign	Het
Dhx8	A	G	11: 101,766,758	K1212E	possibly damaging	Het
Dnah8	A	G	17: 30,737,333	T2096A	probably damaging	Het
Eprs	T	G	1: 185,394,425	N519K	possibly damaging	Het
Fam3c	T	C	6: 22,355,062		probably benign	Het
Galnt17	G	A	5: 131,086,006	R219C	probably damaging	Het
Gm10645	A	G	8: 83,165,857		probably benign	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Hydin	T	G	8: 110,580,709	S3907A	probably benign	Het
Ighv1-49	A	T	12: 115,055,407	V56E	probably damaging	Het
Igtp	A	G	11: 58,206,279	D92G	probably damaging	Het
Itga1	C	T	13: 114,986,171	V750I	probably benign	Het
Kif3c	T	A	12: 3,367,031	Y351N	probably damaging	Het
Klhdc1	T	A	12: 69,283,165	I356N	probably benign	Het
Lrrc34	T	C	3: 30,631,324	Y292C	probably benign	Het
Ly75	G	A	2: 60,352,381	T526M	probably damaging	Het
Mroh4	A	T	15: 74,625,428	D181E	possibly damaging	Het
Nutm1	T	C	2: 112,249,300	N757D	probably benign	Het
Olfr24	A	G	9: 18,755,600	F12L	probably damaging	Het
Olfr384	T	C	11: 73,603,179	F200L	probably benign	Het
Olfr466	T	C	13: 65,152,253	F10L	possibly damaging	Het
Olfr811	T	C	10: 129,802,307	T73A	possibly damaging	Het
Paxbp1	G	A	16: 91,037,397	T167M	probably benign	Het
Pnpla7	A	G	2: 25,052,384	D1238G	probably damaging	Het
Pom121l2	T	C	13: 21,982,188	S210P	probably benign	Het
Ripor3	T	G	2: 167,993,556	N165T	probably benign	Het
Serpine3	T	G	14: 62,670,842	S106R	probably benign	Het
Slc25a11	G	A	11: 70,645,419	R158*	probably null	Het
Slc26a6	G	A	9: 108,859,339	V506M	possibly damaging	Het
Slc45a2	A	G	15: 11,022,083	K304E	probably benign	Het
Slc4a4	C	T	5: 89,028,244	L25F	probably damaging	Het
Smarcb1	T	C	10: 75,904,570	N267S	possibly damaging	Het
Spink6	C	A	18: 44,074,414	Q24K	possibly damaging	Het
Srebf2	T	C	15: 82,195,003	S811P	probably benign	Het
Ssc4d	A	G	5: 135,960,894	*587R	probably null	Het
Sult2a8	C	T	7: 14,427,840	R27H	probably benign	Het
Sun2	C	T	15: 79,738,868	A90T	probably benign	Het
Ubr7	T	C	12: 102,768,267	S267P	probably benign	Het
Wdr55	G	A	18: 36,760,395	V37M	possibly damaging	Het
Xdh	C	T	17: 73,941,115	G45S	probably damaging	Het
Zfp638	T	A	6: 83,943,129	S570T	probably damaging	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8539:Ephb4	UTSW	5	137357855	missense	probably damaging	1.00
R8904:Ephb4	UTSW	5	137370805	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
R9513:Ephb4	UTSW	5	137363302	missense	possibly damaging	0.76
R9659:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
R9788:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTGTAGGTGATCAATGCCATTG -3'
(R):5'- AATAGTGAGGCTGCCGTTGG -3'

Sequencing Primer
(F):5'- CATTGAACAGGACTACCGGCTG -3'
(R):5'- CTGCCGTTGGTCCAAGAGTG -3'

Posted On

2016-11-09