Incidental Mutation 'R5662:Acsm4'
ID444133
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Nameacyl-CoA synthetase medium-chain family member 4
SynonymsOMACS, O-MACS
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119690026-119714565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119694800 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 131 (N131K)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047045
AA Change: N131K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: N131K

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119711419 nonsense probably null
IGL01676:Acsm4 APN 7 119708643 missense probably benign 0.00
IGL01801:Acsm4 APN 7 119707263 missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119693852 splice site probably null
IGL02220:Acsm4 APN 7 119711172 missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119710684 missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119703423 splice site probably benign
I0000:Acsm4 UTSW 7 119711192 missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119698575 missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119708710 missense probably benign 0.00
R1386:Acsm4 UTSW 7 119698578 missense probably benign
R1433:Acsm4 UTSW 7 119693819 missense probably damaging 0.99
R1961:Acsm4 UTSW 7 119708740 missense probably benign 0.04
R3957:Acsm4 UTSW 7 119703365 missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119693785 missense probably benign
R4072:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4075:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4076:Acsm4 UTSW 7 119698758 missense probably benign 0.14
R4432:Acsm4 UTSW 7 119711387 missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119698574 missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119698677 missense probably benign
R4992:Acsm4 UTSW 7 119711417 missense probably benign 0.43
R5046:Acsm4 UTSW 7 119703374 missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119712950 missense probably damaging 1.00
R5780:Acsm4 UTSW 7 119693845 missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119711399 missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119693710 missense probably benign 0.01
R7892:Acsm4 UTSW 7 119694666 missense possibly damaging 0.48
R8716:Acsm4 UTSW 7 119708660 missense probably damaging 1.00
R8738:Acsm4 UTSW 7 119705041 missense probably benign 0.00
Z1177:Acsm4 UTSW 7 119711371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTTCCTGGCCAGTCTG -3'
(R):5'- CAACTCTGAATAGTGCAACTCTC -3'

Sequencing Primer
(F):5'- TTCCTGGCCAGTCTGGAGAG -3'
(R):5'- TGCTGGGATCATAGAAACCTGTCC -3'
Posted On2016-11-09