Incidental Mutation 'R5662:Olfr24'
ID444137
Institutional Source Beutler Lab
Gene Symbol Olfr24
Ensembl Gene ENSMUSG00000054141
Gene Nameolfactory receptor 24
SynonymsMOR132-1, GA_x6K02T2PVTD-12498544-12497603, MTPCR51
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18751507-18763996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18755600 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000149702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066997] [ENSMUST00000216754]
Predicted Effect probably damaging
Transcript: ENSMUST00000066997
AA Change: F12L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064189
Gene: ENSMUSG00000054141
AA Change: F12L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-64 PFAM
Pfam:7TM_GPCR_Srsx 35 304 9.2e-9 PFAM
Pfam:7tm_1 41 290 3.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212239
AA Change: F12L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214366
Predicted Effect probably damaging
Transcript: ENSMUST00000216754
AA Change: F12L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Olfr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Olfr24 APN 9 18754769 missense probably damaging 0.97
IGL02371:Olfr24 APN 9 18754704 missense probably benign 0.07
IGL02555:Olfr24 APN 9 18755473 missense probably benign 0.40
IGL03025:Olfr24 APN 9 18755369 missense probably benign 0.00
IGL03259:Olfr24 APN 9 18755515 missense probably benign
IGL03050:Olfr24 UTSW 9 18755454 nonsense probably null
R0310:Olfr24 UTSW 9 18755333 missense possibly damaging 0.91
R0410:Olfr24 UTSW 9 18754841 missense probably damaging 0.96
R2152:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2153:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2918:Olfr24 UTSW 9 18755479 missense probably damaging 1.00
R4552:Olfr24 UTSW 9 18755134 missense possibly damaging 0.60
R5073:Olfr24 UTSW 9 18754822 missense possibly damaging 0.89
R5539:Olfr24 UTSW 9 18754838 missense probably damaging 0.99
R6145:Olfr24 UTSW 9 18755569 missense probably benign 0.06
R7125:Olfr24 UTSW 9 18754878 nonsense probably null
R7196:Olfr24 UTSW 9 18755590 nonsense probably null
R7607:Olfr24 UTSW 9 18754882 missense possibly damaging 0.93
Z1177:Olfr24 UTSW 9 18755519 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCAAGGAGAGATTGGCCAGG -3'
(R):5'- TTGTGTGAAATGGGAATATTCAGAAG -3'

Sequencing Primer
(F):5'- TTGGCCAGGAAGAAATACATAGG -3'
(R):5'- GCTCAGACAAGAACTGGA -3'
Posted On2016-11-09