Incidental Mutation 'R5662:Smarcb1'
ID444141
Institutional Source Beutler Lab
Gene Symbol Smarcb1
Ensembl Gene ENSMUSG00000000902
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
SynonymsSnf5, SNF5/INI1, integrase interactor 1, Ini1, Baf47
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75896769-75921617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75904570 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 267 (N267S)
Ref Sequence ENSEMBL: ENSMUSP00000000925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000925] [ENSMUST00000121304] [ENSMUST00000140388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000925
AA Change: N267S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902
AA Change: N267S

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121304
AA Change: N258S

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902
AA Change: N258S

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133189
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140408
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that relieves repressive chromatin structures, allowing the transcriptional machinery to access its targets more effectively. The encoded nuclear protein may also bind to and enhance the DNA joining activity of HIV-1 integrase. This gene has been found to be a tumor suppressor, and mutations in it have been associated with malignant rhabdoid tumors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to peri-implantation lethality, likely due to an inability of the blastocysts to hatch and implant in the uterus. A subset of heterozygous null mice develop a variety of tumors in the soft tissues of the head and neck. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Smarcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Smarcb1 APN 10 75916768 splice site probably null
IGL02399:Smarcb1 APN 10 75897494 missense probably damaging 1.00
IGL02457:Smarcb1 APN 10 75921371 missense probably benign 0.01
R0505:Smarcb1 UTSW 10 75897066 missense probably damaging 1.00
R1120:Smarcb1 UTSW 10 75921323 missense probably benign
R2846:Smarcb1 UTSW 10 75897541 missense probably damaging 1.00
R3725:Smarcb1 UTSW 10 75916786 missense probably benign 0.00
R5089:Smarcb1 UTSW 10 75915179 missense probably benign 0.00
R5157:Smarcb1 UTSW 10 75911794 intron probably benign
R5632:Smarcb1 UTSW 10 75904418 nonsense probably null
R7472:Smarcb1 UTSW 10 75897539 missense probably damaging 1.00
R8112:Smarcb1 UTSW 10 75910152 critical splice donor site probably null
Z1176:Smarcb1 UTSW 10 75906077 missense probably benign 0.00
Z1177:Smarcb1 UTSW 10 75904511 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTTATCCTACCTGAAGGCATAG -3'
(R):5'- TAGTGACAACCTGGAAGTCGG -3'

Sequencing Primer
(F):5'- CATAGGTCTTCTGGTGCCAGC -3'
(R):5'- CTGGAAGTCGGGGAGGTC -3'
Posted On2016-11-09