Incidental Mutation 'R5662:Kif3c'
ID444149
Institutional Source Beutler Lab
Gene Symbol Kif3c
Ensembl Gene ENSMUSG00000020668
Gene Namekinesin family member 3C
SynonymsN-4 kinesin
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3365132-3406494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3367031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 351 (Y351N)
Ref Sequence ENSEMBL: ENSMUSP00000151286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020999] [ENSMUST00000220210]
Predicted Effect probably damaging
Transcript: ENSMUST00000020999
AA Change: Y351N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020999
Gene: ENSMUSG00000020668
AA Change: Y351N

DomainStartEndE-ValueType
KISc 8 375 5.43e-171 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 435 443 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
Blast:KISc 508 579 3e-8 BLAST
low complexity region 580 602 N/A INTRINSIC
Blast:KISc 603 666 1e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217965
Predicted Effect probably damaging
Transcript: ENSMUST00000220210
AA Change: Y351N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220255
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Kif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0049:Kif3c UTSW 12 3367090 missense possibly damaging 0.91
R0049:Kif3c UTSW 12 3367090 missense possibly damaging 0.91
R0189:Kif3c UTSW 12 3365989 missense probably benign 0.10
R0727:Kif3c UTSW 12 3366776 missense probably benign 0.01
R0885:Kif3c UTSW 12 3365981 start codon destroyed probably benign 0.00
R1796:Kif3c UTSW 12 3367299 missense probably benign 0.01
R2229:Kif3c UTSW 12 3366671 missense probably benign 0.01
R4728:Kif3c UTSW 12 3365873 start gained probably benign
R4870:Kif3c UTSW 12 3401735 missense probably damaging 1.00
R5586:Kif3c UTSW 12 3389656 missense probably benign 0.41
R6969:Kif3c UTSW 12 3366114 missense probably benign 0.30
R7216:Kif3c UTSW 12 3366126 missense probably benign 0.06
R7372:Kif3c UTSW 12 3387592 missense probably benign 0.03
R7533:Kif3c UTSW 12 3366510 missense probably damaging 1.00
X0052:Kif3c UTSW 12 3367027 missense probably benign 0.30
X0064:Kif3c UTSW 12 3366868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCAATCTCTCGCTGTCCGC -3'
(R):5'- AATCACGGACCCCTCTGGATAG -3'

Sequencing Primer
(F):5'- CTCGCTGTCCGCCCTGG -3'
(R):5'- GGCAGACACGGCCTTCTTTC -3'
Posted On2016-11-09