Incidental Mutation 'R5662:Klhdc1'
ID444150
Institutional Source Beutler Lab
Gene Symbol Klhdc1
Ensembl Gene ENSMUSG00000051890
Gene Namekelch domain containing 1
Synonyms
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69241176-69284632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69283165 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 356 (I356N)
Ref Sequence ENSEMBL: ENSMUSP00000068046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063445] [ENSMUST00000173419]
Predicted Effect probably benign
Transcript: ENSMUST00000063445
AA Change: I356N

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068046
Gene: ENSMUSG00000051890
AA Change: I356N

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.4e-11 PFAM
Pfam:Kelch_4 67 122 4.4e-7 PFAM
Pfam:Kelch_6 67 124 1.7e-7 PFAM
Pfam:Kelch_3 79 125 1.8e-8 PFAM
Pfam:Kelch_3 170 205 2.5e-7 PFAM
Pfam:Kelch_2 196 235 2.8e-8 PFAM
Pfam:Kelch_1 196 236 1.4e-6 PFAM
Pfam:Kelch_4 196 245 5.5e-7 PFAM
Pfam:Kelch_3 206 256 3.9e-8 PFAM
Pfam:Kelch_4 247 295 5.3e-10 PFAM
Pfam:Kelch_3 258 307 1.7e-7 PFAM
low complexity region 364 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173419
SMART Domains Protein: ENSMUSP00000134180
Gene: ENSMUSG00000051890

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.7e-11 PFAM
Pfam:Kelch_4 67 123 1.7e-8 PFAM
Pfam:Kelch_6 67 124 5.6e-8 PFAM
Pfam:Kelch_1 68 116 3.2e-6 PFAM
Pfam:Kelch_3 78 126 3.1e-9 PFAM
Pfam:Kelch_3 165 205 2.8e-8 PFAM
Pfam:Kelch_5 193 237 2.7e-6 PFAM
Pfam:Kelch_2 196 235 1.8e-8 PFAM
Pfam:Kelch_6 196 237 2.6e-8 PFAM
Pfam:Kelch_4 196 245 2e-7 PFAM
Pfam:Kelch_3 206 256 2.1e-7 PFAM
Pfam:Kelch_5 245 285 2.4e-6 PFAM
Pfam:Kelch_4 247 299 3.5e-11 PFAM
Pfam:Kelch_6 247 299 3.2e-8 PFAM
Pfam:Kelch_3 258 301 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Klhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Klhdc1 APN 12 69242008 missense possibly damaging 0.92
IGL01432:Klhdc1 APN 12 69251977 missense probably damaging 0.97
IGL02086:Klhdc1 APN 12 69283184 missense probably benign 0.18
IGL02212:Klhdc1 APN 12 69250766 missense probably damaging 1.00
IGL02548:Klhdc1 APN 12 69253718 missense probably benign 0.00
IGL02861:Klhdc1 APN 12 69251451 missense possibly damaging 0.85
R0446:Klhdc1 UTSW 12 69283308 missense probably benign
R0656:Klhdc1 UTSW 12 69258030 missense probably benign
R1528:Klhdc1 UTSW 12 69263198 missense probably benign 0.02
R3001:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R3002:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R4428:Klhdc1 UTSW 12 69268226 intron probably benign
R4738:Klhdc1 UTSW 12 69283133 missense probably benign 0.07
R5009:Klhdc1 UTSW 12 69251938 missense possibly damaging 0.89
R5366:Klhdc1 UTSW 12 69283150 missense probably damaging 0.99
R5619:Klhdc1 UTSW 12 69258145 splice site probably null
R5911:Klhdc1 UTSW 12 69256251 missense possibly damaging 0.80
R5995:Klhdc1 UTSW 12 69250774 missense probably damaging 1.00
R6708:Klhdc1 UTSW 12 69259530 missense possibly damaging 0.75
R6992:Klhdc1 UTSW 12 69253757 missense probably damaging 1.00
R7224:Klhdc1 UTSW 12 69263149 missense probably damaging 1.00
R7597:Klhdc1 UTSW 12 69269868 missense probably damaging 1.00
R7833:Klhdc1 UTSW 12 69283168 missense probably benign 0.12
R8826:Klhdc1 UTSW 12 69258618 missense probably damaging 1.00
R8828:Klhdc1 UTSW 12 69252034 missense probably damaging 1.00
R8880:Klhdc1 UTSW 12 69252043 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTTAACTTCGGTGCTCTG -3'
(R):5'- AATCCAGCCTTCACTGCAG -3'

Sequencing Primer
(F):5'- GAGTTTTAGTGCTCACCTGGCATTC -3'
(R):5'- TCTGATGCAAGCACGCAG -3'
Posted On2016-11-09