Incidental Mutation 'R5662:Itga1'
ID444157
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114986171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 750 (V750I)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: V750I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: V750I

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTACACATGGCTGCAGTC -3'
(R):5'- TGCTCGAACTTTTGCTCGCTAG -3'

Sequencing Primer
(F):5'- ATGGCTGCAGTCACCATCAG -3'
(R):5'- TGCTCGCTAGTTCAACACAGTAG -3'
Posted On2016-11-09