Incidental Mutation 'H8786:Slco4c1'
ID44416
Institutional Source Beutler Lab
Gene Symbol Slco4c1
Ensembl Gene ENSMUSG00000040693
Gene Namesolute carrier organic anion transporter family, member 4C1
SynonymsOATP-H, OATP4C1, PRO2176, OATP-M1, SLC21A20, C330017E21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location96816270-96872171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96841151 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 329 (C329S)
Ref Sequence ENSEMBL: ENSMUSP00000071875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071985]
Predicted Effect probably damaging
Transcript: ENSMUST00000071985
AA Change: C329S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071875
Gene: ENSMUSG00000040693
AA Change: C329S

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
Pfam:MFS_1 102 483 1.3e-19 PFAM
KAZAL 503 547 1.67e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLCO4C1 belongs to the organic anion transporter (OATP) family. OATPs are involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Slco4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Slco4c1 APN 1 96841187 missense probably damaging 0.99
IGL01510:Slco4c1 APN 1 96867953 missense probably damaging 1.00
IGL01674:Slco4c1 APN 1 96842493 missense probably damaging 1.00
IGL02444:Slco4c1 APN 1 96844509 missense probably damaging 1.00
IGL03355:Slco4c1 APN 1 96842507 nonsense probably null
H8562:Slco4c1 UTSW 1 96842485 missense probably benign 0.01
R0350:Slco4c1 UTSW 1 96828849 missense probably benign 0.18
R0463:Slco4c1 UTSW 1 96867920 missense possibly damaging 0.93
R0550:Slco4c1 UTSW 1 96867859 missense probably damaging 1.00
R1122:Slco4c1 UTSW 1 96828836 missense possibly damaging 0.89
R1205:Slco4c1 UTSW 1 96867888 missense probably damaging 1.00
R1215:Slco4c1 UTSW 1 96828871 missense probably damaging 1.00
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1907:Slco4c1 UTSW 1 96842499 missense probably damaging 1.00
R1960:Slco4c1 UTSW 1 96867929 missense probably benign 0.00
R2372:Slco4c1 UTSW 1 96821200 missense probably benign 0.00
R3424:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R3425:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R4292:Slco4c1 UTSW 1 96844656 critical splice acceptor site probably null
R4656:Slco4c1 UTSW 1 96841245 missense probably benign 0.01
R4852:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4854:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4865:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4867:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4898:Slco4c1 UTSW 1 96837512 missense probably damaging 1.00
R4900:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5023:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5074:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5348:Slco4c1 UTSW 1 96842529 missense probably damaging 0.99
R5356:Slco4c1 UTSW 1 96832110 missense probably damaging 1.00
R5471:Slco4c1 UTSW 1 96872045 missense probably benign 0.34
R5683:Slco4c1 UTSW 1 96867834 missense probably damaging 1.00
R5797:Slco4c1 UTSW 1 96819104 missense probably benign 0.04
R5801:Slco4c1 UTSW 1 96872084 missense probably damaging 0.96
R5837:Slco4c1 UTSW 1 96818982 missense probably benign 0.40
R6242:Slco4c1 UTSW 1 96839283 missense probably damaging 0.99
R7014:Slco4c1 UTSW 1 96823781 intron probably null
R7112:Slco4c1 UTSW 1 96841141 missense probably damaging 1.00
R7174:Slco4c1 UTSW 1 96837598 missense possibly damaging 0.87
R7265:Slco4c1 UTSW 1 96871793 missense probably damaging 0.99
R7275:Slco4c1 UTSW 1 96871772 missense probably benign 0.38
R7305:Slco4c1 UTSW 1 96828965 missense probably damaging 1.00
R7428:Slco4c1 UTSW 1 96837520 missense possibly damaging 0.68
R7649:Slco4c1 UTSW 1 96828942 missense probably benign 0.03
Z1176:Slco4c1 UTSW 1 96821230
Predicted Primers PCR Primer
(F):5'- TGGTCCTTGAAAATTACTGACTAACGGC -3'
(R):5'- TGCTATTTGACTCGTGATGGCTTCC -3'

Sequencing Primer
(F):5'- AGGATAGTTCACAGTACTCACTAAG -3'
(R):5'- TTTTAGATAAAGTCAGAGCCTACCCC -3'
Posted On2013-06-11