Incidental Mutation 'R5662:Mroh4'
ID444160
Institutional Source Beutler Lab
Gene Symbol Mroh4
Ensembl Gene ENSMUSG00000022603
Gene Namemaestro heat-like repeat family member 4
Synonyms1700016M24Rik
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74606029-74636353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74625428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 181 (D181E)
Ref Sequence ENSEMBL: ENSMUSP00000117011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023271] [ENSMUST00000137963]
Predicted Effect probably benign
Transcript: ENSMUST00000023271
AA Change: D250E

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023271
Gene: ENSMUSG00000022603
AA Change: D250E

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 520 534 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
SCOP:d1ee4a_ 709 852 3e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137963
AA Change: D181E

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117011
Gene: ENSMUSG00000022603
AA Change: D181E

DomainStartEndE-ValueType
low complexity region 257 268 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
SCOP:d1ee4a_ 640 783 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176767
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Mroh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mroh4 APN 15 74611358 splice site probably benign
IGL02370:Mroh4 APN 15 74625541 missense probably benign 0.00
IGL02598:Mroh4 APN 15 74611243 critical splice donor site probably null
IGL02644:Mroh4 APN 15 74610375 missense possibly damaging 0.90
IGL02666:Mroh4 APN 15 74609775 missense probably benign 0.04
IGL02723:Mroh4 APN 15 74608237 splice site probably benign
IGL02724:Mroh4 APN 15 74606151 missense probably benign 0.00
IGL03000:Mroh4 APN 15 74616114 missense probably benign
IGL03103:Mroh4 APN 15 74616159 missense possibly damaging 0.47
IGL03194:Mroh4 APN 15 74611539 missense probably damaging 1.00
R0013:Mroh4 UTSW 15 74608237 splice site probably benign
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0294:Mroh4 UTSW 15 74606149 missense probably benign
R0346:Mroh4 UTSW 15 74614292 splice site probably benign
R0545:Mroh4 UTSW 15 74625427 missense probably benign 0.00
R0688:Mroh4 UTSW 15 74606678 missense probably damaging 0.98
R1838:Mroh4 UTSW 15 74616113 missense probably benign 0.03
R2037:Mroh4 UTSW 15 74609761 missense possibly damaging 0.91
R4725:Mroh4 UTSW 15 74616107 missense probably damaging 0.99
R4786:Mroh4 UTSW 15 74610234 missense probably benign 0.08
R4798:Mroh4 UTSW 15 74626179 missense probably damaging 1.00
R4945:Mroh4 UTSW 15 74612008 missense probably benign 0.00
R5065:Mroh4 UTSW 15 74628270 splice site probably null
R5476:Mroh4 UTSW 15 74611661 missense probably benign 0.15
R5509:Mroh4 UTSW 15 74606154 missense probably benign 0.00
R5527:Mroh4 UTSW 15 74615016 missense probably damaging 1.00
R5818:Mroh4 UTSW 15 74611982 missense probably damaging 0.98
R5861:Mroh4 UTSW 15 74606607 intron probably benign
R5886:Mroh4 UTSW 15 74606447 missense possibly damaging 0.90
R5935:Mroh4 UTSW 15 74621154 missense probably damaging 1.00
R6008:Mroh4 UTSW 15 74625472 nonsense probably null
R6658:Mroh4 UTSW 15 74621129 missense possibly damaging 0.83
R6689:Mroh4 UTSW 15 74612003 missense probably damaging 1.00
R6739:Mroh4 UTSW 15 74609719 missense probably benign 0.10
R6888:Mroh4 UTSW 15 74613249 missense possibly damaging 0.93
R7088:Mroh4 UTSW 15 74626144 missense probably benign 0.25
R7260:Mroh4 UTSW 15 74608129 missense possibly damaging 0.83
R7365:Mroh4 UTSW 15 74610371 nonsense probably null
R7735:Mroh4 UTSW 15 74625508 missense probably damaging 0.98
R7763:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
R7945:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
R8090:Mroh4 UTSW 15 74624701 missense probably benign 0.41
R8242:Mroh4 UTSW 15 74616308 missense possibly damaging 0.47
Z1177:Mroh4 UTSW 15 74627720 missense probably damaging 1.00
Z1177:Mroh4 UTSW 15 74628002 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGTCCTGGCCTTTCTAAGATTG -3'
(R):5'- AGCCAAGACAGTGCCTATTTTC -3'

Sequencing Primer
(F):5'- CCTGGCCTTTCTAAGATTGAAGAGAG -3'
(R):5'- ATCCTGAAGACCTGTCTG -3'
Posted On2016-11-09