Incidental Mutation 'R5662:Sun2'
ID444163
Institutional Source Beutler Lab
Gene Symbol Sun2
Ensembl Gene ENSMUSG00000042524
Gene NameSad1 and UNC84 domain containing 2
SynonymsUnc84b, B230369L08Rik
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79724070-79742536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79738868 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 90 (A90T)
Ref Sequence ENSEMBL: ENSMUSP00000124504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046259] [ENSMUST00000089311] [ENSMUST00000100439] [ENSMUST00000159660] [ENSMUST00000160355] [ENSMUST00000162499]
Predicted Effect probably benign
Transcript: ENSMUST00000046259
AA Change: A90T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047864
Gene: ENSMUSG00000042524
AA Change: A90T

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
coiled coil region 418 453 N/A INTRINSIC
coiled coil region 491 519 N/A INTRINSIC
Pfam:Sad1_UNC 595 729 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089311
AA Change: A90T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000086724
Gene: ENSMUSG00000042524
AA Change: A90T

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
coiled coil region 386 421 N/A INTRINSIC
coiled coil region 459 487 N/A INTRINSIC
Pfam:Sad1_UNC 563 697 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100439
AA Change: A90T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000098006
Gene: ENSMUSG00000042524
AA Change: A90T

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 416 451 N/A INTRINSIC
coiled coil region 489 517 N/A INTRINSIC
Pfam:Sad1_UNC 593 727 1.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128342
Predicted Effect probably benign
Transcript: ENSMUST00000159660
AA Change: A90T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124504
Gene: ENSMUSG00000042524
AA Change: A90T

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159762
Predicted Effect probably benign
Transcript: ENSMUST00000160355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162392
Predicted Effect probably benign
Transcript: ENSMUST00000162499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231189
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUN1 (MIM 607723) and SUN2 are inner nuclear membrane (INM) proteins that play a major role in nuclear-cytoplasmic connection by formation of a 'bridge' across the nuclear envelope, known as the LINC complex, via interaction with the conserved luminal KASH domain of nesprins (e.g., SYNE1; MIM 608441) located in the outer nuclear membrane (ONM). The LINC complex provides a direct connection between the nuclear lamina and the cytoskeleton, which contributes to nuclear positioning and cellular rigidity (summary by Haque et al., 2010 [PubMed 19933576]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Sun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03325:Sun2 APN 15 79738648 missense probably benign 0.34
R0049:Sun2 UTSW 15 79727609 splice site probably benign
R0049:Sun2 UTSW 15 79727609 splice site probably benign
R0189:Sun2 UTSW 15 79737076 missense probably damaging 1.00
R0349:Sun2 UTSW 15 79730232 missense probably damaging 1.00
R1183:Sun2 UTSW 15 79728468 missense probably damaging 1.00
R1751:Sun2 UTSW 15 79725557 missense probably benign
R1767:Sun2 UTSW 15 79725557 missense probably benign
R1843:Sun2 UTSW 15 79737563 missense probably benign
R2005:Sun2 UTSW 15 79726624 missense possibly damaging 0.80
R2062:Sun2 UTSW 15 79738651 missense probably damaging 1.00
R2358:Sun2 UTSW 15 79727913 missense possibly damaging 0.95
R3712:Sun2 UTSW 15 79727913 missense possibly damaging 0.95
R3937:Sun2 UTSW 15 79734155 missense probably benign 0.14
R3938:Sun2 UTSW 15 79734155 missense probably benign 0.14
R4869:Sun2 UTSW 15 79728386 intron probably benign
R4871:Sun2 UTSW 15 79727564 missense probably damaging 1.00
R5375:Sun2 UTSW 15 79727522 missense probably damaging 1.00
R5482:Sun2 UTSW 15 79737511 missense probably benign 0.01
R5555:Sun2 UTSW 15 79734127 missense probably benign 0.01
R5657:Sun2 UTSW 15 79727949 nonsense probably null
R6144:Sun2 UTSW 15 79730332 missense probably benign
R6975:Sun2 UTSW 15 79734219 nonsense probably null
R7127:Sun2 UTSW 15 79727899 missense probably benign 0.00
R7358:Sun2 UTSW 15 79734112 missense probably benign 0.29
R7614:Sun2 UTSW 15 79739024 splice site probably null
R8181:Sun2 UTSW 15 79725520 missense probably damaging 0.99
Z1177:Sun2 UTSW 15 79738520 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGCTCTCAGAACCACC -3'
(R):5'- GAGGGTTATTGGCTTCCCCTTC -3'

Sequencing Primer
(F):5'- ACAGGGGCTCCACTGAGATC -3'
(R):5'- TTCCTGGCTGGGCTCAC -3'
Posted On2016-11-09