Incidental Mutation 'R5662:Wdr55'
ID444168
Institutional Source Beutler Lab
Gene Symbol Wdr55
Ensembl Gene ENSMUSG00000042660
Gene NameWD repeat domain 55
Synonyms
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36760239-36763708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36760395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 37 (V37M)
Ref Sequence ENSEMBL: ENSMUSP00000039010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007042] [ENSMUST00000049323] [ENSMUST00000061522]
Predicted Effect probably benign
Transcript: ENSMUST00000007042
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049323
AA Change: V37M

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660
AA Change: V37M

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Wdr55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Wdr55 APN 18 36762079 critical splice donor site probably null
IGL02720:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02723:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02726:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02728:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02729:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02731:Wdr55 APN 18 36763382 missense probably benign 0.12
R1420:Wdr55 UTSW 18 36760339 missense probably benign 0.00
R1952:Wdr55 UTSW 18 36760384 missense probably damaging 1.00
R2143:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R2144:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R4323:Wdr55 UTSW 18 36763100 missense probably benign 0.00
R4497:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R4937:Wdr55 UTSW 18 36762398 missense probably benign 0.00
R6315:Wdr55 UTSW 18 36762069 missense probably damaging 1.00
R6499:Wdr55 UTSW 18 36762178 missense probably benign 0.00
R6679:Wdr55 UTSW 18 36763124 missense probably damaging 1.00
R7038:Wdr55 UTSW 18 36760420 missense probably damaging 1.00
R7151:Wdr55 UTSW 18 36762936 missense possibly damaging 0.48
R7687:Wdr55 UTSW 18 36762023 missense probably damaging 1.00
R7808:Wdr55 UTSW 18 36760416 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAATCCTCCCAGTGCACTTC -3'
(R):5'- TGTTACTGAACGATTCGGGCC -3'

Sequencing Primer
(F):5'- AGTGCACTTCCGATCCCG -3'
(R):5'- GCCGTCTGAGTCTCATAAGATGC -3'
Posted On2016-11-09