Incidental Mutation 'R5662:Ccdc186'
ID444171
Institutional Source Beutler Lab
Gene Symbol Ccdc186
Ensembl Gene ENSMUSG00000035173
Gene Namecoiled-coil domain containing 186
SynonymsOtg1, A630007B06Rik, 1810028B20Rik
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56787481-56822190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56793488 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 753 (I753T)
Ref Sequence ENSEMBL: ENSMUSP00000113457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076085] [ENSMUST00000118592]
Predicted Effect probably benign
Transcript: ENSMUST00000076085
AA Change: I753T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075454
Gene: ENSMUSG00000035173
AA Change: I753T

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118592
AA Change: I753T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113457
Gene: ENSMUSG00000035173
AA Change: I753T

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135666
AA Change: I28T
SMART Domains Protein: ENSMUSP00000122539
Gene: ENSMUSG00000035173
AA Change: I28T

DomainStartEndE-ValueType
Blast:SPEC 2 75 2e-15 BLAST
coiled coil region 149 188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156708
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Ssc4d A G 5: 135,960,894 *587R probably null Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Ccdc186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Ccdc186 APN 19 56813447 missense probably benign 0.18
IGL00976:Ccdc186 APN 19 56797500 missense probably damaging 1.00
IGL01146:Ccdc186 APN 19 56809317 missense probably damaging 1.00
IGL01316:Ccdc186 APN 19 56813413 missense probably benign 0.01
IGL01627:Ccdc186 APN 19 56792020 missense probably damaging 1.00
IGL02325:Ccdc186 APN 19 56813356 missense probably benign 0.03
IGL02755:Ccdc186 APN 19 56813396 missense probably benign 0.06
IGL02899:Ccdc186 APN 19 56793488 missense probably benign 0.00
IGL03408:Ccdc186 APN 19 56798731 missense probably benign 0.00
receding UTSW 19 56800129 missense probably damaging 1.00
R1256:Ccdc186 UTSW 19 56797621 missense probably benign 0.20
R1728:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1729:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1784:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1813:Ccdc186 UTSW 19 56800169 missense probably benign 0.03
R1909:Ccdc186 UTSW 19 56793361 missense probably damaging 1.00
R2110:Ccdc186 UTSW 19 56800142 missense possibly damaging 0.80
R2319:Ccdc186 UTSW 19 56797567 missense possibly damaging 0.50
R2351:Ccdc186 UTSW 19 56798697 missense possibly damaging 0.89
R2970:Ccdc186 UTSW 19 56806998 missense probably damaging 1.00
R4159:Ccdc186 UTSW 19 56793492 nonsense probably null
R4898:Ccdc186 UTSW 19 56802000 splice site probably null
R4910:Ccdc186 UTSW 19 56798691 missense probably damaging 0.98
R5325:Ccdc186 UTSW 19 56813181 missense probably damaging 0.99
R5338:Ccdc186 UTSW 19 56813257 missense possibly damaging 0.87
R5773:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6621:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6806:Ccdc186 UTSW 19 56800129 missense probably damaging 1.00
R6908:Ccdc186 UTSW 19 56791939 critical splice donor site probably null
R6977:Ccdc186 UTSW 19 56798787 missense probably benign 0.05
R7108:Ccdc186 UTSW 19 56798760 missense probably damaging 1.00
R7190:Ccdc186 UTSW 19 56792000 missense probably damaging 1.00
R7407:Ccdc186 UTSW 19 56813385 missense probably benign 0.00
R7408:Ccdc186 UTSW 19 56808178 missense probably damaging 1.00
R7437:Ccdc186 UTSW 19 56806997 missense probably damaging 1.00
R8219:Ccdc186 UTSW 19 56793345 missense probably benign 0.42
R8422:Ccdc186 UTSW 19 56813185 missense probably benign 0.26
R8537:Ccdc186 UTSW 19 56810245 missense probably damaging 1.00
R8777:Ccdc186 UTSW 19 56813361 missense probably damaging 0.98
R8777-TAIL:Ccdc186 UTSW 19 56813361 missense probably damaging 0.98
RF014:Ccdc186 UTSW 19 56813472 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCATGCTACCACAGTAATAC -3'
(R):5'- GTGTAACATAACAGACACTGCTC -3'

Sequencing Primer
(F):5'- TGCTACCACAGTAATACATACTTGG -3'
(R):5'- AGACACTGCTCACTGCTGCTG -3'
Posted On2016-11-09