Incidental Mutation 'R5663:Agfg1'
ID444175
Institutional Source Beutler Lab
Gene Symbol Agfg1
Ensembl Gene ENSMUSG00000026159
Gene NameArfGAP with FG repeats 1
SynonymsC130049H11Rik, Rip, D730048C23Rik, Hrb
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82839483-82901182 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82893452 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 444 (S444R)
Ref Sequence ENSEMBL: ENSMUSP00000141157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063380] [ENSMUST00000113444] [ENSMUST00000186302] [ENSMUST00000187899] [ENSMUST00000189220] [ENSMUST00000190052]
Predicted Effect probably damaging
Transcript: ENSMUST00000063380
AA Change: S447R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070250
Gene: ENSMUSG00000026159
AA Change: S447R

DomainStartEndE-ValueType
ArfGap 11 135 9.31e-52 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.43e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 518 558 2.43e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113444
AA Change: S437R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109071
Gene: ENSMUSG00000026159
AA Change: S437R

DomainStartEndE-ValueType
ArfGap 11 135 4.7e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.62e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 520 560 2.62e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000186302
AA Change: S468R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140785
Gene: ENSMUSG00000026159
AA Change: S468R

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.62e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 520 560 2.62e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000187899
AA Change: S428R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139503
Gene: ENSMUSG00000026159
AA Change: S428R

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 215 231 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
internal_repeat_1 375 410 6.63e-6 PROSPERO
low complexity region 412 425 N/A INTRINSIC
low complexity region 449 470 N/A INTRINSIC
internal_repeat_1 480 520 6.63e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000189220
AA Change: S468R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140170
Gene: ENSMUSG00000026159
AA Change: S468R

DomainStartEndE-ValueType
ArfGap 11 135 9.31e-52 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.43e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 518 558 2.43e-6 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000190046
AA Change: S488R
Predicted Effect probably damaging
Transcript: ENSMUST00000190052
AA Change: S444R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141157
Gene: ENSMUSG00000026159
AA Change: S444R

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 215 231 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
internal_repeat_1 375 410 2.33e-5 PROSPERO
low complexity region 465 486 N/A INTRINSIC
internal_repeat_1 496 536 2.33e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Male mice homozygous for disruptions in this gene are infertile as a result of abnormalities in spermatogenesis. Otherwise, males and females are normal and live a normal life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Agfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Agfg1 APN 1 82858403 missense probably damaging 1.00
IGL02066:Agfg1 APN 1 82893558 missense probably damaging 1.00
IGL02447:Agfg1 APN 1 82882223 splice site probably benign
R0038:Agfg1 UTSW 1 82886102 splice site probably benign
R0038:Agfg1 UTSW 1 82886102 splice site probably benign
R0548:Agfg1 UTSW 1 82886431 missense probably damaging 0.97
R0962:Agfg1 UTSW 1 82886396 missense probably damaging 1.00
R1213:Agfg1 UTSW 1 82875334 missense probably damaging 1.00
R1638:Agfg1 UTSW 1 82893538 missense probably damaging 1.00
R4078:Agfg1 UTSW 1 82882287 missense possibly damaging 0.94
R4477:Agfg1 UTSW 1 82875340 missense probably damaging 1.00
R4780:Agfg1 UTSW 1 82886387 missense probably damaging 1.00
R5103:Agfg1 UTSW 1 82893567 missense probably damaging 1.00
R5576:Agfg1 UTSW 1 82870724 missense probably benign 0.01
R6314:Agfg1 UTSW 1 82858434 missense probably damaging 1.00
R6699:Agfg1 UTSW 1 82858454 splice site probably null
R7266:Agfg1 UTSW 1 82882245 missense probably benign 0.00
R7408:Agfg1 UTSW 1 82882309 missense probably damaging 1.00
R7474:Agfg1 UTSW 1 82882411 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCTAGGTTACCACAGACAG -3'
(R):5'- TAAAACGACTGCAGTCTTAAGGC -3'

Sequencing Primer
(F):5'- AGTGTTTAACTGTACTGACTTTGTC -3'
(R):5'- ACTGCAGTCTTAAGGCAGTCTG -3'
Posted On2016-11-09