Incidental Mutation 'R5663:Nelfb'
ID444178
Institutional Source Beutler Lab
Gene Symbol Nelfb
Ensembl Gene ENSMUSG00000013465
Gene Namenegative elongation factor complex member B
SynonymsA730008L03Rik, Cobra1
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25199712-25211489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25203489 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 417 (E417V)
Ref Sequence ENSEMBL: ENSMUSP00000057731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059849]
Predicted Effect probably benign
Transcript: ENSMUST00000059849
AA Change: E417V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465
AA Change: E417V

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124900
SMART Domains Protein: ENSMUSP00000115296
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 1 144 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138199
Predicted Effect probably benign
Transcript: ENSMUST00000140934
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205741
AA Change: E366V
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit B of a metazoan-specific, four-subunit protein complex that regulates promoter-proximal pausing of RNA polymerase II. RNA polymerase II pausing is thought to be important for coordination of gene transcription during embryonic development and stress responses. Consistently, disruption of this gene in mouse causes inner cell mass deficiency and embryonic lethality. In addition, this gene is required for maintenance of mouse embryonic stem cells by preventing expression of developmental genes. In adult mice, conditional deletion of this gene results in cardiomyopathy and impaired response to cardiac stress. Multiple protein isoforms are encoded through the use of a non-AUG (CUG) initiation codon and an alternative downstream AUG initiation codon. In addition, alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele fail to develop inner cell masses and die between E5 and E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Nelfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Nelfb APN 2 25204288 missense possibly damaging 0.94
IGL01573:Nelfb APN 2 25203957 missense probably damaging 1.00
IGL03109:Nelfb APN 2 25201061 missense possibly damaging 0.95
IGL03255:Nelfb APN 2 25203195 missense probably benign 0.21
R0541:Nelfb UTSW 2 25203980 missense probably benign 0.01
R2046:Nelfb UTSW 2 25206311 missense probably damaging 0.97
R4832:Nelfb UTSW 2 25209969 missense probably damaging 1.00
R4995:Nelfb UTSW 2 25206196 missense probably benign 0.01
R5299:Nelfb UTSW 2 25210745 missense probably benign 0.20
R5854:Nelfb UTSW 2 25209993 missense probably damaging 1.00
R5987:Nelfb UTSW 2 25203888 missense probably damaging 1.00
R6747:Nelfb UTSW 2 25203381 missense probably benign 0.09
R7025:Nelfb UTSW 2 25210493 missense probably damaging 1.00
R8118:Nelfb UTSW 2 25205159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCATGGTCTTCAGTCAGC -3'
(R):5'- CTCAACATGAGTCTCAGGAAACAG -3'

Sequencing Primer
(F):5'- GCAGCGCCACTCTCATG -3'
(R):5'- CATGAGTCTCAGGAAACAGGGAGG -3'
Posted On2016-11-09