Mutagenetix > Incidental Mutation

Incidental Mutation 'R5663:Pik3ca'

444182

Institutional Source

Beutler Lab

Gene Symbol

Pik3ca

Ensembl Gene

ENSMUSG00000027665

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Synonyms

caPI3K, 6330412C24Rik, p110alpha

MMRRC Submission

043306-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32397671-32468486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32462779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1052 (T1052M)

Ref Sequence

ENSEMBL: ENSMUSP00000103878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]

AlphaFold

P42337

Predicted Effect

probably damaging
Transcript: ENSMUST00000029201
AA Change: T1052M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: T1052M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108242
AA Change: T930M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: T930M

Domain	Start	End	E-Value	Type
PI3K_rbd	51	170	5e-47	SMART
PI3K_C2	200	303	2.39e-35	SMART
C2	211	319	3.95e-1	SMART
PI3Ka	396	582	8.35e-99	SMART
Blast:PI3Kc	611	644	1e-11	BLAST
PI3Kc	676	943	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108243
AA Change: T1052M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: T1052M

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195230

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	A	G	11: 76,000,221	K54E	probably damaging	Het
1700021F07Rik	C	T	2: 173,527,897	P68L	probably damaging	Het
5330417C22Rik	T	C	3: 108,492,083	T64A	probably benign	Het
Adgra3	T	C	5: 49,999,285	N368D	probably benign	Het
Agfg1	T	A	1: 82,893,452	S444R	probably damaging	Het
Arhgap44	A	T	11: 65,024,291	F384I	probably damaging	Het
Atp8b2	T	C	3: 89,941,794	N1078D	probably benign	Het
Bcan	G	A	3: 87,995,613	T286I	probably damaging	Het
Cacna1d	A	G	14: 30,123,340	L624P	probably damaging	Het
Dnah7c	C	A	1: 46,535,148	F994L	probably damaging	Het
Dpp6	A	G	5: 27,049,622	I12V	possibly damaging	Het
Edil3	A	G	13: 89,042,508	I101M	probably damaging	Het
Fam160a1	T	C	3: 85,672,433	T822A	probably benign	Het
Farp2	T	C	1: 93,570,013	V255A	probably damaging	Het
Fzr1	A	G	10: 81,370,526	S137P	probably benign	Het
Gm884	A	G	11: 103,613,123	V497A	probably benign	Het
H2-Eb2	T	C	17: 34,333,408	F76L	possibly damaging	Het
Helb	A	G	10: 120,105,793	I330T	possibly damaging	Het
Il18rap	T	A	1: 40,531,557	C220S	probably damaging	Het
Kdm4c	T	C	4: 74,399,348	V966A	probably damaging	Het
Kdm5b	T	C	1: 134,630,635	V1460A	probably benign	Het
Kif15	T	A	9: 122,991,851		probably null	Het
Masp1	T	C	16: 23,452,938	E621G	possibly damaging	Het
Mier1	T	A	4: 103,150,542	S285T	probably damaging	Het
Mroh6	A	G	15: 75,888,588	S46P	probably benign	Het
Myo1h	A	T	5: 114,334,094	Q395L	probably damaging	Het
Ndufb5	T	C	3: 32,747,749	I86T	possibly damaging	Het
Nelfb	T	A	2: 25,203,489	E417V	probably benign	Het
Nfkb1	T	G	3: 135,603,851	D494A	possibly damaging	Het
Nid1	G	A	13: 13,472,834	C395Y	probably damaging	Het
Nr4a3	G	T	4: 48,055,931	R319I	probably damaging	Het
Olfr1508	A	T	14: 52,463,595	I138K	probably benign	Het
Olfr523	G	A	7: 140,176,321	C67Y	probably damaging	Het
Olfr695	T	A	7: 106,873,670	T192S	probably benign	Het
Paqr5	A	G	9: 61,968,862	V130A	probably benign	Het
Phlpp2	G	A	8: 109,904,344	V207I	probably benign	Het
Pikfyve	T	C	1: 65,216,028	Y347H	probably benign	Het
Ptprz1	A	G	6: 23,035,143	H1964R	probably damaging	Het
Rassf7	C	T	7: 141,217,090	T72I	probably damaging	Het
Rfx3	A	G	19: 27,793,617	F603S	probably damaging	Het
Slc27a4	T	A	2: 29,812,370	V477D	probably damaging	Het
Slc9a3	A	C	13: 74,163,712	D593A	probably damaging	Het
Smyd1	A	G	6: 71,239,721	I14T	probably benign	Het
Sox6	T	A	7: 115,550,054	I404L	probably benign	Het
Tas2r121	G	A	6: 132,700,557	H151Y	probably benign	Het
Tgfb1	C	T	7: 25,694,281	T192M	possibly damaging	Het
Ubr4	T	C	4: 139,428,583	Y2240H	possibly damaging	Het
Whrn	T	A	4: 63,418,448	N626Y	probably damaging	Het
Wisp2	G	A	2: 163,825,253	R58Q	probably damaging	Het
Xrra1	T	A	7: 99,886,043	I185N	probably damaging	Het
Zfp94	G	A	7: 24,302,827	R397W	probably damaging	Het

Other mutations in Pik3ca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Pik3ca	APN	3	32462584	missense	probably damaging	1.00
IGL01894:Pik3ca	APN	3	32450026	missense	possibly damaging	0.91
IGL03118:Pik3ca	APN	3	32459935	missense	probably damaging	1.00
IGL03184:Pik3ca	APN	3	32439886	missense	probably benign	0.27
IGL03401:Pik3ca	APN	3	32437814	splice site	probably null
Interrupted	UTSW	3	32438062	missense	probably damaging	1.00
Lilfella	UTSW	3	32454420	missense	probably damaging	1.00
Peninsular	UTSW	3	32462821	missense	probably benign	0.38
Severed	UTSW	3	32437927	missense	possibly damaging	0.65
R0084:Pik3ca	UTSW	3	32462788	missense	possibly damaging	0.78
R0116:Pik3ca	UTSW	3	32459945	missense	probably damaging	1.00
R0278:Pik3ca	UTSW	3	32439753	missense	possibly damaging	0.60
R0513:Pik3ca	UTSW	3	32461511	missense	probably damaging	1.00
R0543:Pik3ca	UTSW	3	32450261	critical splice acceptor site	probably null
R0622:Pik3ca	UTSW	3	32436552	missense	probably damaging	1.00
R0630:Pik3ca	UTSW	3	32450027	missense	possibly damaging	0.91
R1193:Pik3ca	UTSW	3	32456093	missense	probably damaging	0.99
R1292:Pik3ca	UTSW	3	32454420	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1869:Pik3ca	UTSW	3	32450350	missense	probably damaging	0.99
R1962:Pik3ca	UTSW	3	32443867	missense	probably benign	0.27
R1969:Pik3ca	UTSW	3	32451754	critical splice acceptor site	probably null
R2006:Pik3ca	UTSW	3	32450057	missense	probably damaging	1.00
R2264:Pik3ca	UTSW	3	32437927	missense	possibly damaging	0.65
R2366:Pik3ca	UTSW	3	32462794	nonsense	probably null
R2680:Pik3ca	UTSW	3	32436548	nonsense	probably null
R2680:Pik3ca	UTSW	3	32443885	missense	probably benign	0.00
R3001:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R3002:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R4303:Pik3ca	UTSW	3	32439935	nonsense	probably null
R4416:Pik3ca	UTSW	3	32461530	missense	probably damaging	0.99
R4758:Pik3ca	UTSW	3	32437978	missense	probably benign	0.20
R4822:Pik3ca	UTSW	3	32437982	missense	probably benign	0.04
R4856:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R4886:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R5297:Pik3ca	UTSW	3	32450053	missense	probably damaging	1.00
R5636:Pik3ca	UTSW	3	32461560	missense	probably damaging	1.00
R6249:Pik3ca	UTSW	3	32461563	missense	probably damaging	1.00
R6264:Pik3ca	UTSW	3	32440714	critical splice donor site	probably null
R6347:Pik3ca	UTSW	3	32462821	missense	probably benign	0.38
R6538:Pik3ca	UTSW	3	32439704	missense	probably damaging	1.00
R7020:Pik3ca	UTSW	3	32436279	missense	probably damaging	0.97
R7720:Pik3ca	UTSW	3	32436218	missense	probably damaging	1.00
R7864:Pik3ca	UTSW	3	32443613	nonsense	probably null
R8218:Pik3ca	UTSW	3	32437847	missense	possibly damaging	0.74
R8478:Pik3ca	UTSW	3	32451848	missense	probably benign
R9100:Pik3ca	UTSW	3	32460019	missense	probably damaging	1.00
R9169:Pik3ca	UTSW	3	32449606	critical splice donor site	probably null
R9255:Pik3ca	UTSW	3	32442832	critical splice donor site	probably null
R9267:Pik3ca	UTSW	3	32438062	missense	probably damaging	1.00
R9278:Pik3ca	UTSW	3	32454438	missense	probably damaging	1.00
R9501:Pik3ca	UTSW	3	32449913	missense	probably damaging	1.00
R9555:Pik3ca	UTSW	3	32451767	missense	probably damaging	1.00
Z1177:Pik3ca	UTSW	3	32437967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCATGCCAATCTCTTCATC -3'
(R):5'- TATCAAACCCTGCTTGCGTG -3'

Sequencing Primer
(F):5'- GCCTTGGACAAAACTGAG -3'
(R):5'- AAACCCTGCTTGCGTGTACAG -3'

Posted On

2016-11-09