Incidental Mutation 'R5663:Pik3ca'
ID 444182
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
Synonyms 6330412C24Rik, caPI3K, p110alpha
MMRRC Submission 043306-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5663 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 32451203-32520256 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32516928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1052 (T1052M)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
AlphaFold P42337
Predicted Effect probably damaging
Transcript: ENSMUST00000029201
AA Change: T1052M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: T1052M

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108242
AA Change: T930M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: T930M

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108243
AA Change: T1052M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: T1052M

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195230
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 T C 5: 50,156,627 (GRCm39) N368D probably benign Het
Agfg1 T A 1: 82,871,173 (GRCm39) S444R probably damaging Het
Arhgap44 A T 11: 64,915,117 (GRCm39) F384I probably damaging Het
Atp8b2 T C 3: 89,849,101 (GRCm39) N1078D probably benign Het
Bcan G A 3: 87,902,920 (GRCm39) T286I probably damaging Het
Cacna1d A G 14: 29,845,297 (GRCm39) L624P probably damaging Het
Ccn5 G A 2: 163,667,173 (GRCm39) R58Q probably damaging Het
Cimip1 C T 2: 173,369,690 (GRCm39) P68L probably damaging Het
Dnah7c C A 1: 46,574,308 (GRCm39) F994L probably damaging Het
Dpp6 A G 5: 27,254,620 (GRCm39) I12V possibly damaging Het
Edil3 A G 13: 89,190,627 (GRCm39) I101M probably damaging Het
Elapor1 T C 3: 108,399,399 (GRCm39) T64A probably benign Het
Farp2 T C 1: 93,497,735 (GRCm39) V255A probably damaging Het
Fhip1a T C 3: 85,579,740 (GRCm39) T822A probably benign Het
Fzr1 A G 10: 81,206,360 (GRCm39) S137P probably benign Het
H2-Eb2 T C 17: 34,552,382 (GRCm39) F76L possibly damaging Het
Helb A G 10: 119,941,698 (GRCm39) I330T possibly damaging Het
Il18rap T A 1: 40,570,717 (GRCm39) C220S probably damaging Het
Kdm4c T C 4: 74,317,585 (GRCm39) V966A probably damaging Het
Kdm5b T C 1: 134,558,373 (GRCm39) V1460A probably benign Het
Kif15 T A 9: 122,820,916 (GRCm39) probably null Het
Liat1 A G 11: 75,891,047 (GRCm39) K54E probably damaging Het
Lrrc37 A G 11: 103,503,949 (GRCm39) V497A probably benign Het
Masp1 T C 16: 23,271,688 (GRCm39) E621G possibly damaging Het
Mier1 T A 4: 103,007,739 (GRCm39) S285T probably damaging Het
Mroh6 A G 15: 75,760,437 (GRCm39) S46P probably benign Het
Myo1h A T 5: 114,472,155 (GRCm39) Q395L probably damaging Het
Ndufb5 T C 3: 32,801,898 (GRCm39) I86T possibly damaging Het
Nelfb T A 2: 25,093,501 (GRCm39) E417V probably benign Het
Nfkb1 T G 3: 135,309,612 (GRCm39) D494A possibly damaging Het
Nid1 G A 13: 13,647,419 (GRCm39) C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 (GRCm39) R319I probably damaging Het
Or2ag13 T A 7: 106,472,877 (GRCm39) T192S probably benign Het
Or4e1 A T 14: 52,701,052 (GRCm39) I138K probably benign Het
Or6f2 G A 7: 139,756,234 (GRCm39) C67Y probably damaging Het
Paqr5 A G 9: 61,876,144 (GRCm39) V130A probably benign Het
Phlpp2 G A 8: 110,630,976 (GRCm39) V207I probably benign Het
Pikfyve T C 1: 65,255,187 (GRCm39) Y347H probably benign Het
Ptprz1 A G 6: 23,035,142 (GRCm39) H1964R probably damaging Het
Rassf7 C T 7: 140,797,003 (GRCm39) T72I probably damaging Het
Rfx3 A G 19: 27,771,017 (GRCm39) F603S probably damaging Het
Slc27a4 T A 2: 29,702,382 (GRCm39) V477D probably damaging Het
Slc9a3 A C 13: 74,311,831 (GRCm39) D593A probably damaging Het
Smyd1 A G 6: 71,216,705 (GRCm39) I14T probably benign Het
Sox6 T A 7: 115,149,289 (GRCm39) I404L probably benign Het
Tas2r121 G A 6: 132,677,520 (GRCm39) H151Y probably benign Het
Tgfb1 C T 7: 25,393,706 (GRCm39) T192M possibly damaging Het
Ubr4 T C 4: 139,155,894 (GRCm39) Y2240H possibly damaging Het
Whrn T A 4: 63,336,685 (GRCm39) N626Y probably damaging Het
Xrra1 T A 7: 99,535,250 (GRCm39) I185N probably damaging Het
Zfp94 G A 7: 24,002,252 (GRCm39) R397W probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32,516,733 (GRCm39) missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32,504,175 (GRCm39) missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32,514,084 (GRCm39) missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32,494,035 (GRCm39) missense probably benign 0.27
IGL03401:Pik3ca APN 3 32,491,963 (GRCm39) splice site probably null
Interrupted UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
Lilfella UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
Peninsular UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
Severed UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R0084:Pik3ca UTSW 3 32,516,937 (GRCm39) missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32,514,094 (GRCm39) missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32,493,902 (GRCm39) missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32,515,660 (GRCm39) missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32,504,410 (GRCm39) critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32,490,701 (GRCm39) missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32,504,176 (GRCm39) missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32,510,242 (GRCm39) missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32,504,499 (GRCm39) missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32,498,016 (GRCm39) missense probably benign 0.27
R1969:Pik3ca UTSW 3 32,505,903 (GRCm39) critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32,504,206 (GRCm39) missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32,516,943 (GRCm39) nonsense probably null
R2680:Pik3ca UTSW 3 32,498,034 (GRCm39) missense probably benign 0.00
R2680:Pik3ca UTSW 3 32,490,697 (GRCm39) nonsense probably null
R3001:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32,494,084 (GRCm39) nonsense probably null
R4416:Pik3ca UTSW 3 32,515,679 (GRCm39) missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32,492,127 (GRCm39) missense probably benign 0.20
R4822:Pik3ca UTSW 3 32,492,131 (GRCm39) missense probably benign 0.04
R4856:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32,504,202 (GRCm39) missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32,515,709 (GRCm39) missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32,515,712 (GRCm39) missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32,494,863 (GRCm39) critical splice donor site probably null
R6347:Pik3ca UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
R6538:Pik3ca UTSW 3 32,493,853 (GRCm39) missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32,490,428 (GRCm39) missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32,490,367 (GRCm39) missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32,497,762 (GRCm39) nonsense probably null
R8218:Pik3ca UTSW 3 32,491,996 (GRCm39) missense possibly damaging 0.74
R8478:Pik3ca UTSW 3 32,505,997 (GRCm39) missense probably benign
R9100:Pik3ca UTSW 3 32,514,168 (GRCm39) missense probably damaging 1.00
R9169:Pik3ca UTSW 3 32,503,755 (GRCm39) critical splice donor site probably null
R9255:Pik3ca UTSW 3 32,496,981 (GRCm39) critical splice donor site probably null
R9267:Pik3ca UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
R9278:Pik3ca UTSW 3 32,508,587 (GRCm39) missense probably damaging 1.00
R9501:Pik3ca UTSW 3 32,504,062 (GRCm39) missense probably damaging 1.00
R9555:Pik3ca UTSW 3 32,505,916 (GRCm39) missense probably damaging 1.00
Z1177:Pik3ca UTSW 3 32,492,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCATGCCAATCTCTTCATC -3'
(R):5'- TATCAAACCCTGCTTGCGTG -3'

Sequencing Primer
(F):5'- GCCTTGGACAAAACTGAG -3'
(R):5'- AAACCCTGCTTGCGTGTACAG -3'
Posted On 2016-11-09