Incidental Mutation 'R5663:Ndufb5'
ID444183
Institutional Source Beutler Lab
Gene Symbol Ndufb5
Ensembl Gene ENSMUSG00000027673
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Synonyms0610007D05Rik
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.750) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32736990-32751566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32747749 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 86 (I86T)
Ref Sequence ENSEMBL: ENSMUSP00000117240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029217] [ENSMUST00000121778] [ENSMUST00000122290] [ENSMUST00000127477] [ENSMUST00000139593] [ENSMUST00000154257]
Predicted Effect probably benign
Transcript: ENSMUST00000029217
Predicted Effect possibly damaging
Transcript: ENSMUST00000121778
AA Change: I101T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113169
Gene: ENSMUSG00000027673
AA Change: I101T

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 163 5.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122290
AA Change: I31T

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113602
Gene: ENSMUSG00000027673
AA Change: I31T

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 119 1.1e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127477
AA Change: I101T

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114963
Gene: ENSMUSG00000027673
AA Change: I101T

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 189 3.5e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139593
AA Change: I99T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115088
Gene: ENSMUSG00000027673
AA Change: I99T

DomainStartEndE-ValueType
Pfam:NDUF_B5 6 172 6e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154257
AA Change: I86T

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117240
Gene: ENSMUSG00000027673
AA Change: I86T

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 135 8.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156174
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Ndufb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ndufb5 APN 3 32744899 missense probably damaging 0.98
IGL01688:Ndufb5 APN 3 32746464 nonsense probably null
IGL02629:Ndufb5 APN 3 32737199 missense probably benign 0.02
R0084:Ndufb5 UTSW 3 32737203 missense probably benign 0.02
R2851:Ndufb5 UTSW 3 32746451 missense probably damaging 1.00
R5742:Ndufb5 UTSW 3 32747781 missense probably damaging 0.99
R6609:Ndufb5 UTSW 3 32741683 missense probably benign 0.01
Z31818:Ndufb5 UTSW 3 32746461 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTCCTGTGTTACACCTACAGG -3'
(R):5'- AGGAGAGGAACCAAATTCTACTGAC -3'

Sequencing Primer
(F):5'- CTGTGTTACACCTACAGGATGAC -3'
(R):5'- AGATGGCTCAGCAGTTTAGATCCC -3'
Posted On2016-11-09