Incidental Mutation 'R5663:Smyd1'
ID444199
Institutional Source Beutler Lab
Gene Symbol Smyd1
Ensembl Gene ENSMUSG00000055027
Gene NameSET and MYND domain containing 1
SynonymsBop, 4632404M21Rik
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71213940-71322233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71239721 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 14 (I14T)
Ref Sequence ENSEMBL: ENSMUSP00000109826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074301] [ENSMUST00000114186] [ENSMUST00000114188]
Predicted Effect probably benign
Transcript: ENSMUST00000074301
AA Change: I48T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073911
Gene: ENSMUSG00000055027
AA Change: I48T

DomainStartEndE-ValueType
SET 7 259 2.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114186
AA Change: I48T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109824
Gene: ENSMUSG00000055027
AA Change: I48T

DomainStartEndE-ValueType
SET 7 246 2.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114188
AA Change: I14T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109826
Gene: ENSMUSG00000055027
AA Change: I14T

DomainStartEndE-ValueType
Pfam:zf-MYND 18 56 5.4e-11 PFAM
SET 76 225 1.53e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at E10.5. Mutant embryos exhibit an enlarged heart and developmental abnormalities of the right ventricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Smyd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Smyd1 APN 6 71221023 unclassified probably benign
IGL02901:Smyd1 APN 6 71238630 missense probably benign 0.00
PIT4498001:Smyd1 UTSW 6 71219288 missense probably benign 0.00
R0134:Smyd1 UTSW 6 71216765 missense probably damaging 1.00
R1344:Smyd1 UTSW 6 71262167 missense probably benign 0.36
R1418:Smyd1 UTSW 6 71262167 missense probably benign 0.36
R1737:Smyd1 UTSW 6 71216891 missense probably damaging 1.00
R1909:Smyd1 UTSW 6 71239579 missense probably benign 0.34
R1978:Smyd1 UTSW 6 71312719 splice site probably null
R2281:Smyd1 UTSW 6 71238676 missense probably damaging 0.99
R2418:Smyd1 UTSW 6 71239553 missense probably damaging 1.00
R4914:Smyd1 UTSW 6 71219337 missense probably benign 0.00
R5395:Smyd1 UTSW 6 71219390 missense possibly damaging 0.95
R5589:Smyd1 UTSW 6 71262180 missense probably damaging 1.00
R6572:Smyd1 UTSW 6 71225412 missense probably damaging 1.00
R7014:Smyd1 UTSW 6 71238627 missense probably damaging 1.00
R7074:Smyd1 UTSW 6 71237375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGATGTTCTCGTTGGGC -3'
(R):5'- AATATGGGCAAAGGCACCC -3'

Sequencing Primer
(F):5'- GGGCACTTTCCCATATTTCTTGATGG -3'
(R):5'- TTCTTAGACCAGAGGCGTCGATC -3'
Posted On2016-11-09