Incidental Mutation 'H8786:Hsd11b1'
ID44420
Institutional Source Beutler Lab
Gene Symbol Hsd11b1
Ensembl Gene ENSMUSG00000016194
Gene Namehydroxysteroid 11-beta dehydrogenase 1
Synonyms11beta-hydroxysteroid dehydrogenase type 1, 11beta-HSD-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #H8786 (G3) of strain 617
Quality Score88
Status Not validated
Chromosome1
Chromosomal Location193221634-193264075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 193240252 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 166 (A166S)
Ref Sequence ENSEMBL: ENSMUSP00000124693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016338] [ENSMUST00000159644] [ENSMUST00000160929] [ENSMUST00000161737] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably benign
Transcript: ENSMUST00000016338
AA Change: A166S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000016338
Gene: ENSMUSG00000016194
AA Change: A166S

DomainStartEndE-ValueType
Pfam:adh_short 35 230 1.1e-53 PFAM
Pfam:KR 36 215 2.4e-9 PFAM
Pfam:adh_short_C2 41 248 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159644
AA Change: A166S

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124693
Gene: ENSMUSG00000016194
AA Change: A166S

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:adh_short 47 214 2.1e-32 PFAM
Pfam:KR 48 223 1.6e-10 PFAM
Pfam:adh_short_C2 53 221 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160929
AA Change: A136S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123849
Gene: ENSMUSG00000016194
AA Change: A136S

DomainStartEndE-ValueType
Pfam:adh_short 5 172 1.5e-32 PFAM
Pfam:KR 6 184 8.2e-11 PFAM
Pfam:adh_short_C2 11 218 1.6e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161406
AA Change: A53S
SMART Domains Protein: ENSMUSP00000124142
Gene: ENSMUSG00000016194
AA Change: A53S

DomainStartEndE-ValueType
Pfam:adh_short 1 72 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161737
AA Change: A166S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125620
Gene: ENSMUSG00000016194
AA Change: A166S

DomainStartEndE-ValueType
Pfam:adh_short 35 202 2.6e-32 PFAM
Pfam:KR 36 216 1.7e-10 PFAM
Pfam:adh_short_C2 41 248 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162842
SMART Domains Protein: ENSMUSP00000124715
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 1 132 4.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191977
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194677
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display improved glucose tolerance and lower circulating lipid levels. Mice homozygous for a different targeted allele exhibit decreased susceptibility to weight gain, adiposis or hyperinsulinemia induced by 11-DHC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Hsd11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Hsd11b1 APN 1 193241458 start codon destroyed probably null 0.43
IGL00969:Hsd11b1 APN 1 193223644 nonsense probably null
IGL02068:Hsd11b1 APN 1 193222046 nonsense probably null
IGL02331:Hsd11b1 APN 1 193240616 missense probably damaging 1.00
R0207:Hsd11b1 UTSW 1 193240248 missense probably damaging 1.00
R0267:Hsd11b1 UTSW 1 193241397 missense probably damaging 1.00
R0334:Hsd11b1 UTSW 1 193242168 intron probably benign
R0591:Hsd11b1 UTSW 1 193229676 intron probably benign
R1244:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R1569:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1570:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1892:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R2021:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2022:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2023:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R5061:Hsd11b1 UTSW 1 193242245 missense probably benign
R5531:Hsd11b1 UTSW 1 193240249 frame shift probably null
R5768:Hsd11b1 UTSW 1 193240246 missense probably damaging 0.99
R5793:Hsd11b1 UTSW 1 193242184 missense probably damaging 1.00
R5795:Hsd11b1 UTSW 1 193240632 missense possibly damaging 0.85
R6359:Hsd11b1 UTSW 1 193242352 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGCTTTGACCAAGCCTGAC -3'
(R):5'- TATCTCTTTGCAGGCGGACTGGAC -3'

Sequencing Primer
(F):5'- CAAGTCCCTGATGAGTGAACCTG -3'
(R):5'- CGGACTGGACATGCTTATTCTAAAC -3'
Posted On2013-06-11