Incidental Mutation 'R5663:Tas2r121'
ID444200
Institutional Source Beutler Lab
Gene Symbol Tas2r121
Ensembl Gene ENSMUSG00000071150
Gene Nametaste receptor, type 2, member 121
SynonymsTas2r21, T2R21, mGR21, mT2r48
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132700090-132701007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132700557 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 151 (H151Y)
Ref Sequence ENSEMBL: ENSMUSP00000093044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095395]
Predicted Effect probably benign
Transcript: ENSMUST00000095395
AA Change: H151Y

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093044
Gene: ENSMUSG00000071150
AA Change: H151Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 4.5e-108 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Tas2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Tas2r121 APN 6 132700521 missense probably benign 0.28
IGL01868:Tas2r121 APN 6 132700272 missense probably benign 0.00
IGL02182:Tas2r121 APN 6 132700170 missense probably damaging 0.99
IGL02728:Tas2r121 APN 6 132700517 missense probably damaging 1.00
R0833:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R0836:Tas2r121 UTSW 6 132700362 missense probably damaging 1.00
R1181:Tas2r121 UTSW 6 132700169 missense probably damaging 1.00
R1424:Tas2r121 UTSW 6 132700682 missense probably damaging 1.00
R1583:Tas2r121 UTSW 6 132700230 nonsense probably null
R2179:Tas2r121 UTSW 6 132700868 missense probably damaging 1.00
R4711:Tas2r121 UTSW 6 132700890 missense probably benign 0.28
R5274:Tas2r121 UTSW 6 132700848 missense probably damaging 1.00
R5308:Tas2r121 UTSW 6 132700517 missense possibly damaging 0.84
R5668:Tas2r121 UTSW 6 132700793 missense possibly damaging 0.95
R5885:Tas2r121 UTSW 6 132700291 missense probably damaging 1.00
R6395:Tas2r121 UTSW 6 132700532 missense probably benign 0.23
R7552:Tas2r121 UTSW 6 132700542 missense probably benign 0.17
R8094:Tas2r121 UTSW 6 132700809 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCAAGGCATTCACATGGGC -3'
(R):5'- AATCACTTCAGTCTCTGGCTTG -3'

Sequencing Primer
(F):5'- CTCAAGGCATTCACATGGGCTTTAG -3'
(R):5'- GGCTTGCCACTATTCTCAGC -3'
Posted On2016-11-09