Incidental Mutation 'R5663:Zfp94'
ID444201
Institutional Source Beutler Lab
Gene Symbol Zfp94
Ensembl Gene ENSMUSG00000074282
Gene Namezinc finger protein 94
Synonyms
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24301704-24316666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24302827 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 397 (R397W)
Ref Sequence ENSEMBL: ENSMUSP00000104075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032673] [ENSMUST00000077780] [ENSMUST00000108436] [ENSMUST00000145131]
Predicted Effect probably damaging
Transcript: ENSMUST00000032673
AA Change: R391W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032673
Gene: ENSMUSG00000074282
AA Change: R391W

DomainStartEndE-ValueType
KRAB 2 59 3.06e-19 SMART
ZnF_C2H2 157 179 5.06e-2 SMART
ZnF_C2H2 185 207 8.47e-4 SMART
ZnF_C2H2 213 235 4.72e-2 SMART
ZnF_C2H2 241 263 1.28e-3 SMART
ZnF_C2H2 269 291 5.21e-4 SMART
ZnF_C2H2 297 319 9.08e-4 SMART
ZnF_C2H2 325 347 2.09e-3 SMART
ZnF_C2H2 353 375 8.94e-3 SMART
ZnF_C2H2 381 403 2.4e-3 SMART
ZnF_C2H2 409 431 8.6e-5 SMART
ZnF_C2H2 437 459 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077780
SMART Domains Protein: ENSMUSP00000076954
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108436
AA Change: R397W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104075
Gene: ENSMUSG00000074282
AA Change: R397W

DomainStartEndE-ValueType
KRAB 8 65 3.06e-19 SMART
ZnF_C2H2 163 185 5.06e-2 SMART
ZnF_C2H2 191 213 8.47e-4 SMART
ZnF_C2H2 219 241 4.72e-2 SMART
ZnF_C2H2 247 269 1.28e-3 SMART
ZnF_C2H2 275 297 5.21e-4 SMART
ZnF_C2H2 303 325 9.08e-4 SMART
ZnF_C2H2 331 353 2.09e-3 SMART
ZnF_C2H2 359 381 8.94e-3 SMART
ZnF_C2H2 387 409 2.4e-3 SMART
ZnF_C2H2 415 437 8.6e-5 SMART
ZnF_C2H2 443 465 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139811
Predicted Effect probably benign
Transcript: ENSMUST00000145131
SMART Domains Protein: ENSMUSP00000117077
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 64 4.63e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206535
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Other mutations in Zfp94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Zfp94 APN 7 24311481 utr 5 prime probably benign
IGL02645:Zfp94 APN 7 24303754 missense probably benign
R0684:Zfp94 UTSW 7 24303070 missense probably damaging 1.00
R1177:Zfp94 UTSW 7 24303528 missense probably damaging 1.00
R1644:Zfp94 UTSW 7 24311502 splice site probably benign
R1675:Zfp94 UTSW 7 24302834 missense probably damaging 1.00
R1826:Zfp94 UTSW 7 24309115 missense probably damaging 1.00
R1861:Zfp94 UTSW 7 24309116 missense probably damaging 1.00
R3932:Zfp94 UTSW 7 24303687 missense probably benign 0.06
R4912:Zfp94 UTSW 7 24303741 missense probably benign 0.05
R6539:Zfp94 UTSW 7 24303291 missense probably damaging 1.00
R7023:Zfp94 UTSW 7 24303396 missense probably damaging 1.00
R7710:Zfp94 UTSW 7 24303682 missense probably benign
R7810:Zfp94 UTSW 7 24303073 missense probably benign 0.00
R8134:Zfp94 UTSW 7 24303741 missense probably benign 0.40
Z1176:Zfp94 UTSW 7 24303811 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCTGATGCAGGCAAATCC -3'
(R):5'- TCACTGTAGAGTCACACCTTCAAG -3'

Sequencing Primer
(F):5'- TTAGGAGACTTGAGCTCCAGC -3'
(R):5'- TAGAGTCACACCTTCAAGCGCAC -3'
Posted On2016-11-09