Incidental Mutation 'R5663:Xrra1'
ID444203
Institutional Source Beutler Lab
Gene Symbol Xrra1
Ensembl Gene ENSMUSG00000035211
Gene NameX-ray radiation resistance associated 1
Synonyms
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location99859116-99917822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99886043 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 185 (I185N)
Ref Sequence ENSEMBL: ENSMUSP00000147177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036155] [ENSMUST00000207855] [ENSMUST00000208354]
Predicted Effect probably damaging
Transcript: ENSMUST00000036155
AA Change: I185N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035929
Gene: ENSMUSG00000035211
AA Change: I185N

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Blast:LRR 144 168 4e-6 BLAST
LRR 191 214 2.02e-1 SMART
LRR 232 253 1.67e2 SMART
LRR 257 278 6.41e1 SMART
LRR 371 398 4.09e1 SMART
low complexity region 748 756 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207760
Predicted Effect probably damaging
Transcript: ENSMUST00000207855
AA Change: I185N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208548
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Xrra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Xrra1 APN 7 99875194 missense possibly damaging 0.76
IGL01938:Xrra1 APN 7 99879469 critical splice donor site probably null
IGL02064:Xrra1 APN 7 99914204 missense probably damaging 1.00
IGL02286:Xrra1 APN 7 99914227 missense possibly damaging 0.62
IGL02415:Xrra1 APN 7 99915943 missense probably benign
R0332:Xrra1 UTSW 7 99876242 missense probably damaging 1.00
R0465:Xrra1 UTSW 7 99879371 missense probably benign 0.00
R0533:Xrra1 UTSW 7 99875145 splice site probably null
R0601:Xrra1 UTSW 7 99910968 missense possibly damaging 0.95
R1539:Xrra1 UTSW 7 99871357 missense probably damaging 1.00
R1672:Xrra1 UTSW 7 99898440 missense probably benign 0.00
R1687:Xrra1 UTSW 7 99876244 missense probably damaging 1.00
R1962:Xrra1 UTSW 7 99911020 missense probably damaging 1.00
R2504:Xrra1 UTSW 7 99897596 missense probably damaging 1.00
R4765:Xrra1 UTSW 7 99906568 missense probably benign 0.19
R4967:Xrra1 UTSW 7 99906523 missense probably damaging 0.99
R5213:Xrra1 UTSW 7 99898483 missense possibly damaging 0.47
R5986:Xrra1 UTSW 7 99876255 missense probably benign 0.40
R6256:Xrra1 UTSW 7 99914464 missense probably damaging 0.99
R6269:Xrra1 UTSW 7 99917472 missense probably damaging 1.00
R7234:Xrra1 UTSW 7 99914249 missense possibly damaging 0.49
R7316:Xrra1 UTSW 7 99876216 critical splice acceptor site probably null
R7655:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R7656:Xrra1 UTSW 7 99910982 missense probably benign 0.10
X0017:Xrra1 UTSW 7 99916100 missense probably damaging 1.00
X0021:Xrra1 UTSW 7 99898486 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACCCAAGAAGCTATCCTGTGG -3'
(R):5'- TCGCACTGGGCAATCAAAG -3'

Sequencing Primer
(F):5'- CCAAGAAGCTATCCTGTGGGTGAG -3'
(R):5'- CAGAAGAGCTGCTCTGAGCTATTC -3'
Posted On2016-11-09