Incidental Mutation 'R5663:Olfr695'
ID444204
Institutional Source Beutler Lab
Gene Symbol Olfr695
Ensembl Gene ENSMUSG00000108948
Gene Nameolfactory receptor 695
SynonymsGA_x6K02T2PBJ9-9092181-9091234, MOR283-6
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106711031-106716396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106873670 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 192 (T192S)
Ref Sequence ENSEMBL: ENSMUSP00000150853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060879] [ENSMUST00000213721] [ENSMUST00000216009]
Predicted Effect probably benign
Transcript: ENSMUST00000060879
AA Change: T192S

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050694
Gene: ENSMUSG00000109058
AA Change: T192S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.2e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 296 1.8e-6 PFAM
Pfam:7tm_1 41 290 2.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213721
AA Change: T192S

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216009
AA Change: T192S

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217204
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Nr4a3 G T 4: 48,055,931 R319I probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Olfr695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr695 APN 7 106874253 utr 5 prime probably benign
IGL02143:Olfr695 APN 7 106873973 missense probably benign 0.02
R0492:Olfr695 UTSW 7 106873877 missense probably damaging 1.00
R1816:Olfr695 UTSW 7 106873488 nonsense probably null
R1834:Olfr695 UTSW 7 106874141 missense probably damaging 1.00
R2011:Olfr695 UTSW 7 106873427 missense probably benign 0.03
R3434:Olfr695 UTSW 7 106873769 missense probably benign 0.01
R3842:Olfr695 UTSW 7 106874095 missense probably benign 0.07
R4405:Olfr695 UTSW 7 106873373 missense probably damaging 1.00
R4742:Olfr695 UTSW 7 106873428 missense probably damaging 0.99
R4815:Olfr695 UTSW 7 106874237 missense probably benign
R4851:Olfr695 UTSW 7 106874014 missense probably damaging 1.00
R4856:Olfr695 UTSW 7 106873970 missense probably damaging 1.00
R5783:Olfr695 UTSW 7 106873334 missense probably damaging 0.97
R6552:Olfr695 UTSW 7 106714643 small deletion probably benign
R6640:Olfr695 UTSW 7 106714040 missense probably damaging 1.00
R6798:Olfr695 UTSW 7 106714195 missense probably damaging 1.00
R7365:Olfr695 UTSW 7 106713964 missense probably benign 0.03
R7496:Olfr695 UTSW 7 106714228 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TACATGAATGTGGCAGCCCC -3'
(R):5'- TTTGTCACCCGCTGAACTAC -3'

Sequencing Primer
(F):5'- TAGAACATTCCAACTACAGTCAGATG -3'
(R):5'- TGTCACCCGCTGAACTACATGATC -3'
Posted On2016-11-09