Mutagenetix > Incidental Mutation

Incidental Mutation 'R5663:Sox6'

444206

Institutional Source

Beutler Lab

Gene Symbol

Sox6

Ensembl Gene

ENSMUSG00000051910

Gene Name

SRY (sex determining region Y)-box 6

Synonyms

MMRRC Submission

043306-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115470872-116038796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115550054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 404 (I404L)

Ref Sequence

ENSEMBL: ENSMUSP00000145931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]

AlphaFold

P40645

Predicted Effect

probably benign
Transcript: ENSMUST00000072804
AA Change: I403L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: I403L

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106612
AA Change: I361L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: I361L

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
low complexity region	420	442	N/A	INTRINSIC
low complexity region	465	475	N/A	INTRINSIC
HMG	577	647	1.5e-25	SMART
low complexity region	755	767	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166207
AA Change: I403L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: I403L

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166877
AA Change: I363L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: I363L

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169129
AA Change: I363L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: I363L

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205405
AA Change: I404L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205980

Predicted Effect

probably benign
Transcript: ENSMUST00000206034
AA Change: I362L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206369
AA Change: I404L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206775

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	A	G	11: 76,000,221	K54E	probably damaging	Het
1700021F07Rik	C	T	2: 173,527,897	P68L	probably damaging	Het
5330417C22Rik	T	C	3: 108,492,083	T64A	probably benign	Het
Adgra3	T	C	5: 49,999,285	N368D	probably benign	Het
Agfg1	T	A	1: 82,893,452	S444R	probably damaging	Het
Arhgap44	A	T	11: 65,024,291	F384I	probably damaging	Het
Atp8b2	T	C	3: 89,941,794	N1078D	probably benign	Het
Bcan	G	A	3: 87,995,613	T286I	probably damaging	Het
Cacna1d	A	G	14: 30,123,340	L624P	probably damaging	Het
Dnah7c	C	A	1: 46,535,148	F994L	probably damaging	Het
Dpp6	A	G	5: 27,049,622	I12V	possibly damaging	Het
Edil3	A	G	13: 89,042,508	I101M	probably damaging	Het
Fam160a1	T	C	3: 85,672,433	T822A	probably benign	Het
Farp2	T	C	1: 93,570,013	V255A	probably damaging	Het
Fzr1	A	G	10: 81,370,526	S137P	probably benign	Het
Gm884	A	G	11: 103,613,123	V497A	probably benign	Het
H2-Eb2	T	C	17: 34,333,408	F76L	possibly damaging	Het
Helb	A	G	10: 120,105,793	I330T	possibly damaging	Het
Il18rap	T	A	1: 40,531,557	C220S	probably damaging	Het
Kdm4c	T	C	4: 74,399,348	V966A	probably damaging	Het
Kdm5b	T	C	1: 134,630,635	V1460A	probably benign	Het
Kif15	T	A	9: 122,991,851		probably null	Het
Masp1	T	C	16: 23,452,938	E621G	possibly damaging	Het
Mier1	T	A	4: 103,150,542	S285T	probably damaging	Het
Mroh6	A	G	15: 75,888,588	S46P	probably benign	Het
Myo1h	A	T	5: 114,334,094	Q395L	probably damaging	Het
Ndufb5	T	C	3: 32,747,749	I86T	possibly damaging	Het
Nelfb	T	A	2: 25,203,489	E417V	probably benign	Het
Nfkb1	T	G	3: 135,603,851	D494A	possibly damaging	Het
Nid1	G	A	13: 13,472,834	C395Y	probably damaging	Het
Nr4a3	G	T	4: 48,055,931	R319I	probably damaging	Het
Olfr1508	A	T	14: 52,463,595	I138K	probably benign	Het
Olfr523	G	A	7: 140,176,321	C67Y	probably damaging	Het
Olfr695	T	A	7: 106,873,670	T192S	probably benign	Het
Paqr5	A	G	9: 61,968,862	V130A	probably benign	Het
Phlpp2	G	A	8: 109,904,344	V207I	probably benign	Het
Pik3ca	C	T	3: 32,462,779	T1052M	probably damaging	Het
Pikfyve	T	C	1: 65,216,028	Y347H	probably benign	Het
Ptprz1	A	G	6: 23,035,143	H1964R	probably damaging	Het
Rassf7	C	T	7: 141,217,090	T72I	probably damaging	Het
Rfx3	A	G	19: 27,793,617	F603S	probably damaging	Het
Slc27a4	T	A	2: 29,812,370	V477D	probably damaging	Het
Slc9a3	A	C	13: 74,163,712	D593A	probably damaging	Het
Smyd1	A	G	6: 71,239,721	I14T	probably benign	Het
Tas2r121	G	A	6: 132,700,557	H151Y	probably benign	Het
Tgfb1	C	T	7: 25,694,281	T192M	possibly damaging	Het
Ubr4	T	C	4: 139,428,583	Y2240H	possibly damaging	Het
Whrn	T	A	4: 63,418,448	N626Y	probably damaging	Het
Wisp2	G	A	2: 163,825,253	R58Q	probably damaging	Het
Xrra1	T	A	7: 99,886,043	I185N	probably damaging	Het
Zfp94	G	A	7: 24,302,827	R397W	probably damaging	Het

Other mutations in Sox6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Sox6	APN	7	115477206	missense	probably benign
IGL00957:Sox6	APN	7	115777092	missense	probably damaging	1.00
IGL01624:Sox6	APN	7	115476968	missense	probably damaging	1.00
IGL02057:Sox6	APN	7	115550075	missense	probably damaging	1.00
IGL02385:Sox6	APN	7	115550039	missense	possibly damaging	0.77
IGL02410:Sox6	APN	7	115486744	missense	probably damaging	1.00
IGL02736:Sox6	APN	7	115580640	missense	probably damaging	1.00
IGL02747:Sox6	APN	7	115489746	missense	probably damaging	1.00
IGL02792:Sox6	APN	7	115541649	missense	probably benign
PIT4480001:Sox6	UTSW	7	115597509	missense	probably benign	0.03
R0458:Sox6	UTSW	7	115489794	missense	probably damaging	1.00
R0689:Sox6	UTSW	7	115486551	missense	probably damaging	1.00
R0800:Sox6	UTSW	7	115579014	critical splice donor site	probably null
R1220:Sox6	UTSW	7	115662442	missense	probably damaging	1.00
R1474:Sox6	UTSW	7	115701691	splice site	probably benign
R1547:Sox6	UTSW	7	115701722	missense	possibly damaging	0.93
R1570:Sox6	UTSW	7	115777123	missense	probably damaging	1.00
R1674:Sox6	UTSW	7	115801419	missense	probably benign	0.00
R1704:Sox6	UTSW	7	115476948	missense	possibly damaging	0.92
R1754:Sox6	UTSW	7	115477055	missense	probably benign
R1833:Sox6	UTSW	7	115777093	missense	probably damaging	1.00
R1868:Sox6	UTSW	7	115659538	missense	possibly damaging	0.89
R1893:Sox6	UTSW	7	115544568	missense	probably benign	0.28
R2386:Sox6	UTSW	7	115597505	missense	probably damaging	1.00
R2431:Sox6	UTSW	7	115550007	splice site	probably null
R4303:Sox6	UTSW	7	115544469	critical splice donor site	probably null
R4319:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4320:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4321:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4323:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4335:Sox6	UTSW	7	115512724	missense	probably benign
R4567:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R4776:Sox6	UTSW	7	115541670	missense	probably damaging	1.00
R4838:Sox6	UTSW	7	115486662	missense	probably damaging	1.00
R4914:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R4915:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R5184:Sox6	UTSW	7	115777228	missense	probably damaging	1.00
R5372:Sox6	UTSW	7	115550151	nonsense	probably null
R5454:Sox6	UTSW	7	115701773	missense	possibly damaging	0.89
R5685:Sox6	UTSW	7	115579157	splice site	probably null
R5734:Sox6	UTSW	7	115541621	critical splice donor site	probably null
R6020:Sox6	UTSW	7	115486628	missense	probably damaging	1.00
R6211:Sox6	UTSW	7	115801462	missense	probably damaging	1.00
R6263:Sox6	UTSW	7	115477060	missense	probably damaging	1.00
R6549:Sox6	UTSW	7	115486692	missense	possibly damaging	0.79
R6576:Sox6	UTSW	7	115701702	missense	probably damaging	0.96
R6680:Sox6	UTSW	7	115476983	missense	possibly damaging	0.94
R6709:Sox6	UTSW	7	115701789	splice site	probably null
R6747:Sox6	UTSW	7	115541731	missense	probably damaging	1.00
R6755:Sox6	UTSW	7	115662442	missense	probably damaging	0.99
R7233:Sox6	UTSW	7	115489809	missense	possibly damaging	0.80
R7423:Sox6	UTSW	7	115550023	missense	probably benign	0.30
R7455:Sox6	UTSW	7	115489669	missense	probably benign	0.02
R7522:Sox6	UTSW	7	115801578	missense	probably damaging	1.00
R7527:Sox6	UTSW	7	115777173	missense	probably benign	0.00
R7852:Sox6	UTSW	7	115801604	start codon destroyed	probably null	1.00
R7936:Sox6	UTSW	7	115544595	missense	probably benign
R8278:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R8335:Sox6	UTSW	7	115701714	missense	probably damaging	1.00
R8558:Sox6	UTSW	7	115541798	missense	probably benign	0.12
R8682:Sox6	UTSW	7	115476956	missense	probably damaging	1.00
R8693:Sox6	UTSW	7	115662397	missense	probably damaging	0.99
R8712:Sox6	UTSW	7	115597508	missense	probably benign	0.00
R8972:Sox6	UTSW	7	115476983	nonsense	probably null
R9297:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9318:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9517:Sox6	UTSW	7	115512735	missense	possibly damaging	0.79
R9688:Sox6	UTSW	7	115476990	missense	probably benign
X0061:Sox6	UTSW	7	115477148	missense	probably benign	0.00
X0065:Sox6	UTSW	7	115550108	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACACCTGCTTCTCAGTGC -3'
(R):5'- CTGTTATCTGACAATACGGTAAGGG -3'

Sequencing Primer
(F):5'- CATCCCTATAAAGAGGCACATTTGGG -3'
(R):5'- AGACCGATGTTTGCCTTC -3'

Posted On

2016-11-09